1. Artemia authentication by RFLP of mitochondrial rDNA and HSP26-cDNA W. Xiaomei 1,2, F. Catania 1,2, F. Dooms 1,2, G. Van Stappen 2, E. Naessens 3, P. Sorgeloos 2, P. Bossier 1 Artemia INCO workshop, Beijing September 2002 CLO- Sea Fisheries Department 1 Lab Aquaculture and ARC 2 INVE Technologies 3

2. Introduction Diversification of commercial Artemia cyst supply Broader spectrum of cyst samples and characteristics, e.g. –Cyst size –Nauplii size –HUFA –Vitamine C Hence need for the possibility to authenticate cyst samples.

3. Aim Develop a database(s) of DNA fingerprinting patterns that could serve as a tool for authentication commercial Artemia samples

4. Methodology on mt-rDNA DNA extraction from a batch of cysts PCR amplification of rDNA RFLP analysis Data processing

5. Methodology on mt- rDNA (cont) Isolation of DNA from cysts –Pretreatment Suspension of 10 mg cyst in 50 µl for 2h Crushing with sterile pestil –DNA extraction by Promega kit (requiring mostly extra Ph/Chl purification) CTAB extraction Chelex (works also on single cysts)

6. Methodology on mt- rDNA (cont) DNA extraction from a batch of cysts PCR amplification of rDNA RFLP analysis Data processing

7. Methodology (cont) PCR amplification of rDNA

9. Methodology on mt- rDNA (cont) PCR amplification of rDNA 16S rRNA12S rRNA 1500 bp UNIVERSAL PRIMER 12S rDNA AAACTGGGATTAGATACCCCACTAT CT A GGATTAGATACCC T A Artemia 12S-SP primer UNIVERSAL PRIMER 16S rDNA CCGGTCTGAACTCAGATCACGTAG CCGGTCTGAACTCAGATCA Artemia 16S SP primer

10. Methodology on mt- rDNA (cont) PCR amplification of rDNA PCR amplification conditions 94°C, 2 min (94°C 75s, 52°C 45sec, 72°C 2 min) x 34 72°C 2 min Mg Cl 2 : 2.5 mM dNTPs 0.2 mM DNA polymerase: 1.75 U primers: 0.5 µM Target DNA: 50 –100 ng DNA

11. Methodology on mt- rDNA DNA extraction from a batch of cysts PCR amplification of rDNA RFLP analysis Data processing

12. Methodology on mt- rDNA (cont) RFLP analysis Purification of the fragment using Promega kit RFLP analysis using –MseI –Tsp509I –HpaII –NdeII –TaqI –HaeIII –HinfI –DdeI

13. Methodology on mt- rDNA (cont) DNA extraction from a batch of cysts PCR amplification of rDNA RFLP analysis Data processing

14. Methodology mt-rDNA (cont) Data processing Gelcompar software Band assignment Matrix of Dice index of similarity: 2n AB /(n A + n B ) UPGMA dendrogram

16. Detail on the UPGMA dendrogram

19. First analysis There are seven major clusters A. tibetiana Parthenogenetic Artemia A. franciscana A. sinica A. salina A. persimilis A. urmiana

20. Techical problems: RFLP analysis on single cysts RFLP analysis of mitochondrial rDNA on 1 cyst with Nde II on strain ARC1154 1500 1000 500 100 more than one haplotype in a batch of cysts In a single cyst: heteroplasmy or pseudo-genes

21. Techical problems In most of cyst samples these technical problems only occur with one to two enzymes If a real mixture of two species is present in a cyst sample, double restriction patterns are found with all enzymes. In the previously shown dendrogram only samples without apparent technical problems are included.

22. Robustness of the mt- rDNA technique These samples, all containing double restriction patterns with one or more enzymes, were identified against the database

23. Conclusions on the rDNA database The RFLP technique on a batch of cysts is able to differentiate easily between species. Within each species a lot a diversity can be found. Using 8 restriction enzymes only 8x4 nucleotides are probed with this RFLP experimental design, while the fragment is 1500 bp long (so only 2.1%). It is clear that the actual DNA sequence of this fragment would unvail much more variability.

24. Conclusions on the rDNA database (cont) The mitochondrial rDNA is normally used to differentiate families or even species within a genus. Here, using 8 R.E. below-species diversity is very high. This is an indication for high genetic isolation of Artemia habitats. Probably depending on the local geographical conditions, the 8xRFLP technique might be able to differentiate Artemia samples at a local-salt-lake complex level. This would need more validation.

25. Methodology for HSP26 RFLP Total RNA extraction from a batch of cysts RT-PCR amplification of HSP26, yielding a 650 bp fragment RFLP analysis using 7 restriction enzymes Data processing

26. UPGMA dendrogram Using HSP26 data Conclusion: HSP26 is suppossed to be involved in the indogenous stress resistance of cysts. Hence, polymorphism might reflect local adaptation (non-neutral mutations). This needs further study. By studying only the cDNA, the putative non- neutral polymorphism can be studied in detail. HSP26 cDNA can be isolated from cysts. So stored samples can be used as well in such a study.

27. General conclusions RFLP of the rDNA with eight restriction enzymes reveals a lot of polymorphism Within a species, and probably even within a lake, different rDNA haplotypes can be found. Commercial samples can be identified at the species level, even if technical problems like double restriction patterns, are complicating the analysis. For phylogenetic and population genetic studies, RFLP analysis on single cysts or even cloned rDNA fragment are necessary.