1. Chapter 25 Gene Expression and Protein Synthesis Gene Expression and Protein Synthesis

2. Introduction The central dogma of molecular biology Information contained in DNA molecules is expressed in the structure of proteins. Gene expression is the turning on or activation of a gene. eukaryotes (humans) In Nucleus of cell Eukaryotes (humans) In cytoplasm Bacteria (transcriptn + translatn)

3. Transcription -the process by which information encoded in a DNA molecule is copied into an mRNA molecule. 1. Transcription starts when the DNA double helix begins to unwind near the gene to be transcribed. 2. Only one strand of the DNA is transcribed. 3. Ribonucleotides assemble along the unwound DNA strand in a complementary sequence. polymerases (poly)Enzymes called polymerases (poly) catalyze transcription: poly I: formation of  rRNA formation, poly II: formation of  mRNA formation poly III: formation of  tRNA formation. 1. 2.3. 4.

4. Transcription A eukaryotic gene has two RNA; the parts: structural gene 1.A structural gene that is transcribed into structural gene is made of exons and introns. regulatory gene promoter. 2.A regulatory gene that controls transcription; the regulatory gene is not transcribed but has control elements, one of which is the promoter. 3. A promoter is unique to each gene. initiation signal. 4.There is always a sequence of bases on the DNA strand called an initiation signal. consensus sequences,TATA box, 5.Promoters also contain consensus sequences, such as the TATA box, in which the two nucleotides T and A are repeated many times. 1. 2. 3. 4. 5. Figure 25.2

5. RNA in Translation mRNA, rRNA, and tRNA all participate in translation. Protein synthesis takes place on ribosomes (e.g. rRNA). A ribosome dissociates into larger (60S) and a smaller body (40S). The 5’ end of the mature mRNA is bonded to the 40S ribosome and this unit then joined to the 60S ribosome. codons. e.g. AUGTriplets of bases on mRNA are called codons. e.g. AUG The 20 amino acids are then brought to the mRNA-ribosome complex, each amino acid by its own particular tRNA (e.g. w/ Met). rRNA-40S rRNA-60S mRNA tRNA Note: anticodon for AUG: UAC  “Met” see table 25.1

6. tRNA Each tRNA is specific for only one amino acid (e.g. UAC  Met). Cell carries at least 20 specific enzymes (e.g. AARS) each specific for one amino acid. (i.e. links Amino acids with spec. tRNA) NOTE: 20 amino acids always/usually present in cytoplasm to make proteins (usually) otherwise-bad hair day? Poor nutrition... Limited amino acid(s) in diet Challenge Question? What is the only food with all 20 amino acids in one serving? Most important segments of tRNA 1. site where enzymes attach amino acids (3’ end) anticodon: UAC bondS AUG2. recognition site. (three basses anticodon: UAC bondS AUG ) tRNA (AARS) Expanded tRNA (e.g. Met) UAC anticodon 1. 2. mRNA

7. Confirming your Knowledge If a codon is CGU (mRNA) what is it’s anticodon? mRNA What amino acid does the code for? Hint see table 25.1

8. The Genetic Code Assignments of triplets is based on several types of experiments. One of these used synthetic mRNA. If mRNA is polyU, polyPhe is formed; the triplet UUU, therefore, must code for Phe. If mRNA is poly ---ACACAC---, poly(Thr-His) is formed; ACA must code for Thr, and CAC for His. By 1967, the genetic code was broken.

9. The Genetic Code: Table 25.1 NOTE:

10. Features of the Code All 64 codons have been assigned. 61 code for amino acids. (What about the others 3?) 3 (UAA, UAG, and UGA) serve as termination signals. AUG, universal start signal. Only Trp and Met have one codon each. More than one triplet can code for the same amino acid; Leu, Ser, and Arg, for example, are each coded for by six triplets. AUG CGUAGUAAUGGUAGUAUAUAA Stop codon Start codon

11. Features of the Code For the 15 amino acids coded for by 2, 3, or 4 triplets, it is only the third letter of the codon that varies. Gly, for example, is coded for by GGA, GGG, GGC, and GGU. The code is almost universal: it the same in viruses, prokaryotes, and eukaryotes; the only exceptions are some codons in mitochondria. Supports Darwins theory of evolution Confirming your Knowledge If you had 750 DNA segment, (assume Met (AUG) and stop codon UUG are stripped off ) How many Amino acids appear in the protein the DNA codes for?

12. Translation the process whereby a base sequence of mRNA is used to create a protein. There are four major stages in protein synthesis: 1. Activation 2. Initiation 3. Elongation 4. Termination

13. Protein Synthesis Activation 1. Hydrolize ATP  AMP 2. Link adenosine to Amino acid 1. 2.

14. Amino Acid Activation 1. Activated amino acid is bound to spec. tRNA 2. w/ ester carboxyl group of the amino acid and the 3’-OH of the tRNA. (e.g. Cys) (AARS) 1. 2.

15. Chain Initiation Figure 25.4 Formation of an initiation complex. 40S 1. 40S rRNA binds with mRNA 1. 40S 2. tRNA binds with 40S rRNA/mRNA 2. 3. 60S rRNA binds with 40S rRNA/mRNA 3. 60S mRNA P site E site A site Acceptor (A) Site Protein (P) Site Exit (E) Site (tRNA)

16. Elongation: Figure 25.6 Show Videos 26.6 A site P site E site Process: Hydrolyzes GTP  GDP Forms peptide bond (b/w Ala-Met)

17. Peptide Bond Formation Peptide bond formation in protein synthesis.

18. Termination Chain termination requires: Termination codons (UAA, UAG, or UGA) of mRNA. Releasing factors that cleave the polypeptide chain from the last tRNA and release the tRNA from the ribosome. Fig. 25-7, p. 629 UAA (terminate me (‘.’) X-ray model of Ribosome w/ rRNA tRNA mRNA

19. Gene Regulation the various methods used by organisms to control which genes will be expressed and when. transcriptional level1. Regulations operate at the transcriptional level (DNA  RNA) translational level2. Others operate at the translational level (mRNA  protein). In eukaryotes, transcription regulated by 3 elements: promoters, enhancers, and response elements. 1. Transcriptional Level

20. 2. Translational Level a number of mechanisms that ensure quality control. A. aminoacyl-tRNA synthase (AARS) A. aminoacyl-tRNA synthase (AARS) control Each amino acid must bond to the proper tRNA. B. Termination control release factors. stop codons must be recognized by release factors. C. Post-translational control In most proteins, the Met at the N-terminal end is removed by Met-aminopeptidase. chaperonesCertain proteins called chaperones help newly synthesized proteins to fold properly.

21. Mutations and Mutagens Mutation: Mutation: a heritable change in the base sequence of DNA. It is estimated that, on average, there is one copying error for every 10 10 bases. Mutations can occur during replication. Base errors can also occur during transcription in protein synthesis (a nonheritable error). Other errors in replication may lead to a change in protein structure and be very harmful.

22. Mutations and Mutagens Chemical(s) that causes a base change in DNA. What are common mutagens we are all exposed to? nucleotide excision repair (NER) units  prevents mutations. Cells have repair mechanisms called nucleotide excision repair (NER) units  prevents mutations. NER can prevent mutations by cutting out damaged areas and resynthesizing them. Not all mutations are harmful. Certain ones may be beneficial because they enhance the survival rate of the species.

23. Recombinant DNA DNA from two sources that have been combined into one molecule. One example of the technique begins with plasmids found in the cells of Escherichia coli. plasmid:plasmid: a small, circular, double-stranded DNA molecule of bacterial origin. restriction endonucleasesA class of enzymes called restriction endonucleases cleave DNA at specific locations. One, for example, may be specific for cleavage of the bond between A-G in the sequence -CTTAAAG-. Restriction enzyme cleaves here...

24. Recombinant DNA In this example “B ” stands for bacterial gene, and “H for human gene. The DNA is now double-stranded with two “sticky ends”, each with free bases that can pair with a complementary section of DNA. Next, we cut a human gene with the same restriction endonuclease; for example, the gene for human insulin. Sticky ends

25. Recombinant DNA DNA ligase.The human gene is now spliced into the plasmid by the enzyme DNA ligase. Splicing takes place at both ends of the human gene and the plasmid is once again circular. The modified plasmid is then put back into the bacterial cell where it replicates naturally every time the cell divides. These cells now manufacture the human protein, in our example human insulin, by transcription and translation.

26. Recombinant DNA Figure 25.11 The recombinant DNA technique. In 1972, University of California, San Francisco, biochemist Herbert Boyer met Stanford University geneticist Stanley Norman Cohen. Cohen founded Genentech 1976 1 st human insulin produced by fermentation 1972

27. Cloning DNA Figure 26.17 The cloning of human DNA fragments with a viral vector.

28. Gene Therapy Figure 26.18 Gene therapy via retroviruses.

29. End Chapter 26 Protein Synthesis Gene Expression and Protein Synthesis