1. Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer

2. Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

3. Why? RNA

4. How? gene specific DNA probes labeled target gene mRNA

5. Microarrays - The Technologies Stanford-type Microarrays High-density

6. Stanford-type Microarrays

7. Coating glass slides Deposition of probes Post-processing Hybridization

8. Spotting - Mechanical deposition of probes

9. 16-pin microarrayer

11. Microarrayer

12. mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE CONTROL Stanford microarrays

13. Affymetrix GeneChip ® oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data 280-500 K features to play with

14. TTT T T T T T T T A A A A A A A AAA Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1 Mask #2

15. Sample Preparation - Eberwine RNA T7 dsDNA T7 pol SAMPLE ssDNA + Reverse Transcriptase + RNase H + Polymerase clean up dsDNA + Biotin-labeled nucleotides aRNA 42  C 2 h 16  C 2 h 37  C 6 h 70  C 10 min

16. Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG biotinylated anti-anti IgG

17. The Affymetrix GeneChip ® A gene is represented like this: - Perfect Match (PM) - MisMatch (MM) PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

18. NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt) Service: -labelling -scanning -image analysis

19. Photolithography - Micromirrors

20. Analysis of Data Normalization: Linear or non-linear

21. Is it worth it? Number of known positives Number of significantly affected genes Qspline normalization Linear normalization Known positives versus the total number of significantly affected genes at 5 different cutoffs in the TnrA experiment

22. Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principal Component Analysis (PCA) Clustering and visualization

23. Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites,...

24. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical Analysis Fit to Model (time series) Expression Index Calculation Advanced Data Analysis ClusteringPCAClassification Promoter Analysis Meta analysisSurvival analysisRegulatory Network Comparable Gene Expression Data Normalization Image analysis The DNA Array Analysis Pipeline