Download presentation
Presentation is loading. Please wait.
1
pCOLD Vectors and Other Alternative Expression Systems for Structural Genomics
2
Optimal Growth Acclimation Steady Low Temp Growth Stationary Phase Adapted Cells Phase Non-CSPs CSPs Growth Curve Cold- shock adaptation of E. coli < 20 °C 37ºC
3
pCold I (4.4 kb) lacI ColE1 ori Amp M13 IG cspA promoter lac operator cspA 5’UTR TEE His 6 multiple cloning site cspA 3’UTR factor Xa site TEE (translation enhancing element): ATGAATCACAAAGTG (MNHKV) His 6 : CATCATCATCATCATCAT Factor Xa site: ATCGAAGGTAGG (IEGR) Multiple cloning site: CATATGGAGCTCGGTACCCTCGAGGGATCCGAATTCAAGCTTGTCGACCTGCAGTCTAGA NdeI SacI KpnI XhoIBamHI EcoRI HindIII SalIPstI XbaI Maps of pCold vectors pCold III (4.4 kb) lacI ColE1 ori Amp M13 IG lac operator cspA 5’UTR TEE multiple cloning site cspA 3’UTR cspA promoter pCold IV (4.4 kb) lacI ColE1 ori Amp M13 IG lac operator cspA 5’UTR multiple cloning site cspA 3’UTR cspA promoter pCold II (4.4 kb) M13 IG Amp ColE1 ori lacI lac operator cspA 5’UTR TEE His 6 multiple cloning site cspA 3’UTR cspA promoter
4
T S 1 2 trigger factor EnvZ-B T S 1 2 T S calmodulin 1 2 1 2 3 4 5 0 12 24 36 48 hr EnvZ-B 1 2 3 4 5 6 7 SDS-PAGE of whole cell lysates - E.coli EnvZ ATP-binding domain (EnvZ-B), Xenopus calmodulin (CaM) and E.coli trigger factor expressed using pCold vectors EnvZ-B
6
Purified protein NMR Cell lysate NMR [ 1 H- 15 N]-HSQC spectra of 15 N-enriched Xenopus calmodulin produced with pCold vector
7
Sequential connectivity map summarizing the results of triple- resonance NMR experiments with calmodulin in whole cell lysates ~ 80% of the peaks are assigned
8
Target Selection, Cloning and Protein Production Validate/ cDNA Identify Target ORF Clone into Expression Vectors Human, C. elegans, Drosophila, Arabidopsis, yeast and others N/C-Terminal His-Tags, pCold, No tag, MBP, SUMO, Pichia, cell-free Small Scale Expression Large Scale Fermentation/Protein Purification Soluble Insoluble or not expressed
9
Multiplex Expression System Classical Restriction Endonuclease/Ligase- dependent cloning E. coli Expression Vectors Eukaryotic Expression systems
10
Expanded multiplex system 1) Gateway MBP-fusion expression system (Kapust & Waugh 1999) (collaboration with D. Waugh, NCI) 2) SUMO system (Lifesensors, Inc. Malvern, PA) (collaboration with T. Butt, Lifesensors, Inc.) Attempt to use fusion protein expression systems in place of our standard T7 Multiplex Expression System (Acton et al, submitted) for a set of 50 eukaryotic target proteins
11
MBP fusion coupled with cleavage by TEV MBP is cleaved from its fusion partner by Tobacco Etch Virus (TEV) Proteinase TEV recognizes the consensus sequence: Glu-X-X-Tyr-X-Gln-Ser (Routzahn & Waugh 2002) Both in vivo and in vitro cleavage conditions are being investigated Interesting note: Recombinant TEV does not fold properly in vivo and it must be generated as an MBP fusion as well (Dougherty et al., 1989)
12
Summary of MBP screening N/ANE WR15 Y E/S WR14 N/AE/SE/NS WR13 Y E/S WR11 lowE/SNE WR10 N/ANE WR9 Y E/SNEE/SWR8 Y E/SNE WR6 N/ANE WR5 Y E/S WR4 YE/S E/NSWR3 lowE/SNEE/NSWR2 MBP-fusion in vitro cleavage MBP- fusion uncleaved MBP- fusion in vivo cleavage pETTarget Not expressed Expressed/soluble Expressed/insoluble N/ANE E/NSWR54 Y E/S WR53 lowE/S E/NSWR49 N/ANE WR44 N/AE/S WR43 YE/S WR41 lowE/S WR39 N/ANE WR28 lowE/SE/NS WR27 N/AE/SNEE/NSWR26 low E/S PE WR18 N/ANE WR16 MBP-fusion in vitro cleavage MBP- fusion uncleaved MBP- fusion in vivo cleavage pETTarget
13
SUMO system SUMO is a Ubiquitin-like (UBL) protein UBLs are small, highly soluble, globular proteins SUMO has been reported to exhibit chaperone-like activity Ulp1 is used to cleave the protein target from the fusion by recognizing the entire SUMO protein SUMO system utilizes Ni-affinity chromatography Cleavage must occur in vitro (Figure courtesy of www.lifesensors.com) 6хHis SUMOProtein of interest SUMP protease (Ulp1)
14
Summary of SUMO fusion screening Target ID pET (N-terminal His-tag) SUMO fusion AR5NE AR22E/S FR10E/NSE/S HR894E/NS HR1553E/NSE/S HR1686E/NS HR1697NEE/S WR26E/NS Not expressed Expressed/soluble Expressed/insoluble
15
A stable cell-free protein synthesis system prepared from wheat germ Improvement in preparing cell extracts: removing endosperm contaminants, including tritin, thionin, ribonucleases, deoxy ribonucleases, and proteases, by thorough washing and sonication. (Proc. Natl. Acad. Sci. USA 99, 14652-57) Protein synthesis in the dialysis system. (A and B) Coomassie blue-stained SDS polyacrylamide gels showing DHFR synthesis with (A) or without (B) addition of new mRNA. Arrows and asterisks mark DHFR and creatine kinase, respectively. (C) Amounts of DHFR synthesized as determined from densitometric scans of the gels in A (closed circles) and B (open circles). DHFR CK (collaboration with Y. Endo, Ehime University)
16
A cell-free expression vector and its performance GFP mRNA supplement (92 g in 500 l reaction each time) (a) Schematic illustration of pEU. (b) SDS/PAGE analysis of GFP produced during 14 days of reaction. mRNA produced by transcription of circular pEU was used for the translation reaction in the dialysis membrane system and was added every 48 h. A 0.1-µl aliquot of the mixture was run on the gel, and protein bands were stained with CBB. The arrow shows GFP; "st" designates an authentic GFP band (0.5 µg).
17
* * * * * * * * * Protein synthesis of human targets by wheat-germ system
18
Summary of screening by cell-free system from wheat germ Not expressed Expressed/soluble Expressed/insoluble
19
Panel of 50 eukaryotic targets in eight expression systems
20
Acknowledgements Guoliang QingThomas ActonTatsuya Sawasaki Li-Chung MaRong Xiao Yaeta Endo Ahmad KhorchidRitu ShastryKate Drahos G. V. T. SwapnaChi Kent HoTauseef R. Butt Tapas K. MalNatalia DenissovaDavid S. Waugh Masanori Mitta TakayamaBonnie Cooper Bing XiaKellie Cunningham Sangita PhadtareLiang-yu (Lydia) Shih Haiping KeYi-Wen Chiang Gaetano T. Montelione Shin-Geon Choi Mitsuhiko Ikura Masayori Inouye
22
What if…? PCR & cloning of ORFsConstruct validation Small-scale expression & solubility screens Unexpressed or Insoluble Proteins
23
Protein Production Pipeline PCR & cloning of ORFsConstruct validation Small-scale expression & solubility screens using T7 system Analysis & passing of targets to fermentation Large-scale production & purification of 15 N/ 13 C, or selenomethionine-labeled proteins Structure determination by NMR Structure determination by X-ray crystallography
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.