1. Marcatori genetici nel plant breeding

2. Utilizzo Identificazione clonale Analisi dei parentali
Struttura familiare
SCALA
Struttura di popolazione
Flusso genico
Filogeografia
Ibridizzazione
Filogenesi

3. P = E+G Marcatori in biologia
Marcatori fenotipici = caratteri distinguibili a occhio nudo
Colore del fiore, forma del baccello, etc..
P = E+G

4. Karl Von Linne ( )

5. Molecular markers
Sequenze di proteine o DNA facilmente distinguibili, la cui eredità può essere verificata e associata con tratti ereditati indipendentemente dall’ambiente :
a) Polimorfismi di proteine
b) Polimorfismi di DNA

6. Molecular markers Sequenze (SNPs) Microsatelliti (SSRs)
Multi-locus fingerprints
AFLP (Amplified Fragment Length Polymorphism)
Potere di risoluzione
RAPD (random amplified polymorphic DNA)
DNA cloroplastico PCR-RFLP
allozimi (elettroforesi di proteine)

7. Polimorfismi di proteine
Proteine di riserva del seme
Isozimi

8. Isozimi

9. Isozimi
Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).

10. Struttura del DNA dal cromosoma al DNA
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ……….
Stretch of nitrogen fixation gene in soybean

11. molecular marker? DNA M1 M2 Gene A Gene B MFG MFG
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag
MFG M1 M2
DNA
Gene A
Gene B
AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAA
AAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG
MFG
readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance

12. Image from UV light table
Image from computer screen

13. Co-dominant marker Dominant marker Polymorphism -Parent 1 : one band
-Parent 2 : a smaller band
-Offspring 1 : heterozygote = both bands
-Offspring 2 : homozygote parent 1
P 2
P 1
O 2
O 1
Gel configuration
Dominant marker
Polymorphism
Parent 1 : one band
-Parent 2 : no band
-Offspring 1 : homozygote parent 1
-Offspring 2 : ????
P 2
Gel configuration
P 1
O 1
O 2

14. Dominant versus Co-dominant
No distinction between homo- and heterozygotes possible
No allele frequencies available
AFLP, RAPD
Co-dominant:
homozygotes can be distinguished from heterozygotes; allele frequencies can be calculated
microsatellites, SNP, RFLPs

15. Desirable properties for a good
molecular marker
* Polymorphic
* Co-dominant inheritance
* Occurs throughout the genome
* Reproducible
* Easy, fast and cheap to detect
* Selectivity neutral
* High resolution with large number of samples

16. Basis for DNA marker technology
Restriction Endonucleases
Polymerase chain reaction (PCR)
DNA-DNA hybridization
DNA sequencing

17. RFLP based markers
*Examine differences in size of specific DNA restriction fragments
*Require pure, high molecular weight DNA
*Usually performed on total cellular genome

18. Endonucleases and restriction sequences
AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGA
YFG
Ind 1
Ind 2

19. RFLP techniques

20. RFLP Polymorphisms interpretation1
MFG 1 2 3 4 5 6 2 3 4 5 6

21. Advantages and disadvantages of RFLP
Time consuming
Expensive
Use of radioactive probes
Advantages
Reproducible
Co-dominant
Simple

22. DNA/DNA Hybridization
Denaturation
Elevated temperature
Known DNA sequence

23. Polymerase Chain Reaction
Powerful technique for amplifying DNA
Amplified DNA are then separated by gel electrophoresis

24. PCR based methods 1. Reactions conditions *Target DNA ( or template)
*Four nucleotides (dATP, dCTP, dGTP, dTTP)
1. Reactions conditions
*Target DNA ( or template)
*Reaction buffer containing the co-factor MgCl2
*One or more primers
*Thermostable DNA polymerase

25. = an enzyme that can synthesize DNA at
2. Use of DNA polymerase
= an enzyme that can synthesize DNA at
elevated temperature
ex : Taq = enzyme purified from hot spring bacterium : Thermus aquaticus
3. Thermal cycle
*Denaturing step - one to several min at º C
*Annealing step - one to several min at º C
*Elongation step - one to several min at 72 º C
4. Repetition
typically 20 to 50 times average 35 times

26. AFLP Markers Most complex of marker technologies
Involves cleavage of DNA with two different enzymes
Involves ligation of specific linker pairs to the digested DNA
Subsets of the DNA are then amplified by PCR

27. AFLP Markers The PCR products are then separated on acrylamide gel
128 linker combinations are readily available
Therefore 128 subsets can be amplified
Patented technology

31. AFLP Markers Technically demanding Reliable and stable Moderate cost
Need to use different kits adapted to the size of the genome being analyzed.
Like RAPD markers need to be converted to quick and easy PCR based marker

32. RAPD Markers
There are other problems with RAPD markers associated with reliability
Because small changes in any variable can change the result, they are unstable as markers
RAPD markers need to be converted to stable PCR markers.
How?

33. RAPD Markers The polymorphic RAPD marker band is isolated from the gel
It is used a template and re-PCRed
The new PCR product is cloned and sequenced
Once the sequence is determined, new longer and specific primers can be designed

34. RAPD Fast and easy method for detecting polymorphisms Domimant markers
Amplifies anonymous stretches of DNA using arbitrary primers
Fast and easy method for detecting polymorphisms
Domimant markers
Reproducibility problems

35. RAPD Polymorphisms among landraces of sorghum
Sequences of 10-mer
RAPD primers
Name Sequence
OP A08 5’ –GTGACGTAGG- 3’
OP A15 5’ –TTCCGAACCC- 3’
OP A 17 5’ –GACCGCTTGT- 3’
OP A19 5’ –CAAACGTCGG- 3’
OP D02 5’ –GGACCCAACC- 3’ M
RAPD gel configuration

36. SSR repeats and primers
GGT(5)
Sequence
GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC
ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG
ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA…..
GAGGGCTGATGAGGTGGATA
ATCTTATGGCGGTTCTCGTG

37. SSR polymorphisms AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2
Gel configuration

38. Linkage groups

39. SSR scoring for F 5:6 pop from the cross
Anand x N
N97
Anand M

40. 4. SNPs (Single Nucleotide Polymorphisms)
Hybridization using fluorescent dyes
SNPs on a DNA strand
Any two unrelated individuals differ by one base pair every
1,000 or so, referred to as SNPs.
Many SNPs have no effect on cell function and therefore
can be used as molecular markers.

41. DNA sequencing
Sequencing gel
Sequencer
Sequencing graph

42. Types of traits =types of markers
Single gene trait: seed shape
Multigenic trait; ex: plant growth =Quantitative Trait Loci
MFG
MFG

43. USES OF MOLECULAR MARKER
Measure genetic diversity
Mapping
Tagging

44. Genetic Diversity
Define appropriate geographical scales for monitoring and management (epidemology)
Establish gene flow mechanism
identify the origin of individual (mutation detection)
Monitor the effect of management practices
manage small number of individual in ex situ collection
Establish of identity in cultivar and clones (fingerprint)
paternity analysis and forensic

45. Genetic Diversity

46. Gotcha! early selection of the good allele fingerprints seeds,
plantlets

47. A linear order of genes or DNA fragments
Mapping
The determination of the position and relative distances of gene on chromosome by means of their linkage
Genetic map
A linear arrangement of genes or genetic markers obtained based on recombination
Physical map
A linear order of genes or DNA fragments

48. It contains ordered overlapping cloned DNA fragment
Physical Mapping
It contains ordered overlapping cloned DNA fragment
The cloned DNA fragments are usually obtained using restriction enzyme digestion

49. QTL Mapping
A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location
 To assist selection

50. Marker Assisted Selection
Breeding for specific traits in plants and animals is expensive and time consuming
The progeny often need to reach maturity before a determination of the success of the cross can be made
The greater the complexity of the trait, the more time and effort needed to achieve a desirable result.

51. MAS
The goal to MAS is to reduce the time needed to determine if the progeny have trait
The second goal is to reduce costs associated with screening for traits
If you can detect the distinguishing trait at the DNA level you can identify positive selection very early.

52. Developing a Marker
Best marker is DNA sequence responsible for phenotype i.e. gene
If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA
Develop specific primers to gene that will distinguish the two forms

53. Developing a Marker If gene is unknown, screen contrasting populations
Use populations rather than individuals
Need to “blend” genetic differences between individual other than trait of interest

54. Developing Markers
Cross individual differing in trait you wish to develop a marker
Collect progeny and self or polycross the progeny
Collect and select the F2 generation for the trait you are interested in
Select individuals in the F2 showing each trait

55. Developing Markers Extract DNA from selected F2s
Pool equal amounts of DNA from each individual into two samples - one for each trait
Screen pooled or “bulked” DNA with what method of marker method you wish to use
Method is called “Bulked Segregant Analysis”

56. Marker Development
Other methods to develop population for markers exist but are more expensive and slower to develop
Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent
What is the advantage to markers in breeding?

57. Reducing Costs via MAS Example disease resistance
10000 plants
Greenhouse space or field plots
$ $10000
Time 4 months (salary)
$10 - $15000
total cost = $15 - $25,000

58. Reducing Costs via MAS PCR-based testing @ $5 sample
$50,000 - costs more?
Analysis of trait not easily phenotyped
E.g: Cadmium in Durum wheat
10000 plants need to reach maturity
Cadmium accumulates in seed

59. Reducing costs via MAS $15 - 25 growing costs + analysis
Atomic $15 per sample
$150,000 + growing costs
PCR analysis still $50000
Savings in time and money increase as more traits are analyzed
Many biochemical tests cost >$50 sample

60. Marker Assisted Breeding
MAS allows for gene pyramiding - incorporation of multiple genes for a trait
Prevents development of biological resistance to a gene
Reduces space requirements - dispose of unwanted plants and animal early

61. QTL study Types of population used for molecular markers studies:
Trait
2.5
8.4
7.1
4.5
2.3
M. 1 1 3 2
M. 2 1 3
M. 3 1 3 2
P.1
P.2
I.1
I.2
I.3
I.4
Statistical programs used in molecular marker studies
* SAS
* ANOVA * Mapmaker
* Cartographer
Types of population used for molecular markers studies:
F2, RILs, Backcrosses (MILs), DH.

62. QTL Mapping