2. טרנסקריפציה השלב הראשון בתהליך התבטאות הגנים = סינתזת מולקולת RNA

4. What is a (protein-coding) gene? Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

5. The pathway of gene expression Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

6. Some nomenclature conventions RNAP

8. RNADNA

11. RNA Similarities and Differences Between DNA and RNA Similar strand structure Can define a 5’ and 3’ end 2’ hydroxyl in RNA: causes stability differences) Uracil in RNA takes the place of Thymine in in DNA

14. CCA adding enzyme RNase P מולקולת ה-RNA עוברת מבנה שניוני.

15. tRNA

16. מבנה שניוני של RNA Stem & loop

17. ההבדלים בין RNA ל DNA קבוצת OH בעמדה 2 של הריבוז (RNA) לעומת קבוצת H באותה עמדה ב- DNA. קבוצת ה-OH משפיעה על יציבות הקשר הפוספודיאסטרי (קשר הפוספאט). U מחליף T. בסיסים שעוברים מודיפיקציה גדיל ה-RNA יוצר מבנה שיניוני בניגוד ל DNA היוצר מבנה דו-גדילי בין שתי גדילי DNA - המבנה השיניוני של מולקולת ה RNA קובע את פעילות ה RNA.

21. Promoters Transcription starts at promoters on the DNA template RNA polymerase binds tightly to such promoters Sequence of this DNA is represented by the sense strand and has the same sequence and directionality as the transcribed RNA Two common sequences are present upstream (on the 5 ’ side) of the start site Rates at which E. coli genes are transcribed depend upon the stability of the initiation complex between the promotor and RNA polymerase

22. RNA polymerase

23. PromotersPromoters - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). TerminatorsTerminators - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. RNA Polymerase (RNAP)RNA Polymerase (RNAP) - Enzyme for synthesis of RNA. - Enzyme for synthesis of RNA. Reaction (ordered series of steps)Reaction (ordered series of steps) 1) Initiation. 1) Initiation. 2) Elongation. 2) Elongation. 3) Termination. 3) Termination. Bacterial (Prokaryotic) Transcription רצף המכוון את רנא פולימראז תחילת הגן רצף הגורם לרנא פולימראז להפסיק את תרגום הגן

24. Other important nomenclature conventions 5’ 3’ Template strand +1 Transcription Initiation Site Direction of transcription “Downstream”“Upstream” +2+2 +3+3 +4+4 +5+5 +6+6 -3-3 -1 -2-2 -4-4 -5-5 There is no “zero”

25. -10 region RNAP binds a region of DNA from -40 to +20 The sequence of the non-template strand is shown TTGACA…16-19 bp... TATAAT “-35” spacer “-10” Promoter sequences לאורך ה"ספיסר" יש משמעות – ארוך או קצר יוצר פרומוטר חלש

26. E. coli promoter sequences for 13 genes Promoter sequences for mRNAs. RNA polymerase seeks out the consensus sequences for proper orientation for binding to initiate transcription. Note promoter sites have regions of similar sequences at the -35 region and -10 region. Minus numbers represent bases upstream of mRNA start point, +1 is the first base in the RNA transcript. TR5

31. RNA polymerase II

33. Structure of E. coli RNA Polymerase Five core subunits  2  ’ω Sixth subunit (  ) binds core transiently and directs enzyme to specific DNA binding sites Has overall “hand” shape –Similar in structure to DNA polymerase –During chain elongation, thumb closes over DNA- binding channel

34. שלבי הטרנסקריפציה Initiation Elongation Termination

37. פקטור סיגמא

38. Sigma factor

39. Finding and binding the promoter Closed complex formation RNAP bound -40 to +20 Open complex formation RNAP unwinds from - 10 to +2 Binding of 1st NTP Requires high purine [NTP] Addition of next NTPs Requires lower purine [NTPs] Dissociation of sigma After RNA chain is 6-10 NTPs long initiation

40.   (sigma subunit) allows RNA polymerase to recognize and bind specifically to promoter regions. E. coli RNA polymerase +  subunit TR6

41. initiation

42. elongation

43. Chain Elongation RNA synthesis proceeds 5 ’ 3 ’ Double-stranded DNA is open at the point of RNA synthesis Transcription “ bubble ” moves with RNA polymerase DNA becomes more tightly wound (positively supercoiled) ahead of the transcription bubble and unwound (negatively supercoiled) behind the bubble

44. Sense and Antisense DNA Initiation of RNA synthesis occurs at specific sites on DNA DNA strand that serves as the template during transcription is the antisense (noncoding) strand Sense (coding) strand of DNA has the same sequence as the transcribed RNA, except for replacement of U with T

45. RNA polymerase elongation ה"עין" כ-12 זיווגי בסיסים

46. Elongation

47. mRNA Transcription TR7 רנא פולימראז מכניס שגיאה אחת ל-10000 נוקלאוטידים, אין לו מערכת לתיקון שגיאות טופואיזומראז לפני ואחרי רנא פולימראז

48. The theory of the template 2 - better Base pairing explained DNA replication. But no obvious structural complementarity between bases of DNA and amino acids of proteins

49. Subsequent hydrolysis of PPi drives the reaction forward RNA strand OH DNA strand RNA Synthesis is in the 5 ’ to 3 ’ Direction RNA has polarity (5’ phosphate, 3’ hydroxyl)

50. NTPs

51. Rho-Dependent Transcription Termination (depends on a protein AND a DNA sequence) G/C -rich site RNAP slows down Rho helicase catches up Elongating complex is disrupted

52. Rho-Independent Transcription Termination (depends on DNA sequence - NOT a protein factor) Stem-loop structure

53. Rho-independent transcription termination RNAP pauses when it reaches a termination site. The pause may give the hairpin structure time to fold The fold disrupts important interactions between the RNAP and its RNA product The U-rich RNA can dissociate from the template The complex is now disrupted and elongation is terminated

54. Rho-Independent Termination of Prokaryotic Transcription RNA transcript has self-complementary sequences permitting the formation of a hairpin structure Short string of adenylate residues in the template are transcribed into uridylates at the 3 ’ end Formation of hairpin disrupts interactions between RNA and RNA polymerase

55. Rho-Dependent Termination Rho factor (  ) is an ATP-dependent helicase that catalyzes the unwinding of RNA:DNA hybrid duplexes Recognizes C-rich regions in single-stranded RNA Advances in the 5 ’ 3 ’ direction until it reaches the transcription bubble with a paused RNA polymerase Unwinds the RNA-DNA duplex, releasing the RNA transcript Rho factor From Garrett & Grisham, Biochemistry (2 nd edition) Saunders, Fort Worth (1999)

56. termination סיום טרנסקריפציה

57. RNA polymerase

59. termination

61. לפניך הקפאה של מצב נתון בתא. אתה רואה מצב שנקרא Xmas tree מה אתה רואה? 1.גן אחד שלאורכו נוסע רנא פולימראז אחד. 2.שני גנים שלאורך כל אחד נוסע רנא פולימראז אחד. 3.גן אחד שלאורכו נוסעים הרבה רנא פולימראזות. 4.שני גנים שלאורך כל אחד מהם נוסעים הרבה רנא פולימראזות.

62. Xmas tree – transcription

64. Genes and Operons Genes are DNA sequences that encode polypeptides, rRNA, and tRNA, as well as sequences that have a role in initiating and ending transcription Most eukaryotic protein-coding genes are individually transcribed Many prokaryotic genes exist as operons and are transcribed together

65. Prokaryotic genes פוליציסטרוני – יחודי לפרוקריוטיים בלבד. באוקריוטים mRNA אחד יוצר סוג אחד של חלבון

66. Prokaryotic termination

74. מדוע צריך לבקר את אופן התבטאות הגנים בחיידקים? 1. הסביבה בה החיידק נמצא משתנה, והיכולת של החיידק לשרוד בסביבה המשתנה מותנת ביכולתו להתאים את עצמו. 2. על החיידק לבטא את הגנים שלו על מנת לשרוד, אבל להפעלת הגנים ליצור מולקולות רנא וחלבונים יש מחיר אנרגטי יקר. לכן צריך להפעיל את הגנים כאשר זקוקים לתוצרים שלהם. 3. כל התשובות נכונות.

75. חלבונים (והגנים שלהם) המבוטאים כל הזמן נקראים "housekeeping", בעוד שחלבונים המבוטאים כתלות בסביבה נקראים "inducible".

76. Alternate sigma factor usage: controls selective transcription of entire sets of genes s 32 s 60 vegetative (principal s) heat shock nitrogen starvation s 70 TTGACATATAAT (16-19 bp) (5-9 bp) A +1 CNCTTGACCCATNT (13-15 bp) (5-9 bp) A +1 CTGGNA TTGCA (6 bp) (5-9 bp) A +1 Ways to Regulate Transcription

77. Lac operon Lac II אופרון – קבוצת גנים המקודדים לחלבונים מאותו מעגל מטבולי ומאורגנים בקבוצה המבוטאת יחד.

78. טרנסקריפציה בתאים אוקריוטים

81. The pathway of gene expression

82. Pre-mRNA

83. ישנן 22 מולקולות שונות של tRNA בתא עם רצף שונה של נוקלאוטידים. האם לכל סוג של מולקולת tRNA יש גן? 1. כן 2. לא, רק למולקולות ה-mRNA יש גנים. 3. כן, אבל בתאים אוקריוטים הן מסונטזות מגן פוליציסטרוני. 4. לא, רק מולקולות ה-mRNA והריבוזומים מסונטזים מגנים.

85. 5’UTR 3’UTR

86. בתאי כבד בעכבר

87. Eukaryotic Promoters More complex and diverse than prokaryotic promoters RNA polymerase I promoters –Multiple copies of rRNA genes exist –RNA polymerase I recognizes only one species-specific promoter –Requires a core promoter element and an upstream promoter element RNA polymerase III promoters have variable locations relative to the transcribed gene More attention has been paid to RNA polymerase II promoters because they are involved in the transcription of mRNA

88. יעילות ותדירות מיקום +1 רמה נמוכה (בזלית) E S RE אינטרונים

96. שלבי הטרנסקריפציה Initiation Elongation Termination

98. TATA-Binding Protein (TBP) Formation of the preinitiation complex (PIC) begins when TBP protein of TFIID binds the TATA box of a promotor DNA binds the concave surface in a sharply bent conformation Double helix is partially unwound and minor groove widens

101. TFII = transcription factor of RNA PolII ע " מ ש RNA פולימראז יצליח להיקשר לאזור הפרומוטר TF צריכים להיקשר.

102. תהליך ה -INITIATION

103. Initiation complex

106. קומפלקס פרה - איניציציה יציבות ותדירות יצירת קומפלקס זה קובעת את כמות וקצב סינטזת ה -RNA

107. YSPTSPS The number of these repeats varies; the mammalian protein contains 52, while the yeast protein contains 26. Serine 5 phosphorylation is confined to promoter regions and is necessary for the initiation of transcription, whereas Serine 2 phosphorylation is important for mRNA elongation and 3'-end processing

108. Expanding the functions of RNA polymerase

109. אופן אקטיבציה של טרנסקריפציה בתאים אוקריוטים

110. Stages in Initiation of Transcription Bacterial transcription Closed complex: holoenzyme+promoter Open complex (DNA melting, not need ATP ) Abortive transcripton Productive initiation –Transcribe past +9 –Sigma dissociates Elongation Eukaryotic transcription Preinitiation complex (PIC) assembly PIC activation (DNA melting, needs ATP) Abortive transcription Productive initiation –CTD phosphorylated –Promoter clearance Elongation

111. Structure of RNA Polymerase II RNA polymerase II from yeast has been extensively characterized Contains two large subunits that are homologs of prokaryotic RNA polymerase subunits  and  ’ Contains 10 smaller subunits, including homologs of  and  Structural features –Thumb –DNA-binding channel –Channel for single-stranded RNA

112. 3-dimensional view of yeast RNA Pol II Both yeast RNA Pol II and E. coli RNA polymerase core Have a similar shape and have the channel for DNA template. Core Holoenzyme RNA polymerase II from yeast has been extensively characterized Contains two large subunits that are homologs of prokaryotic RNA polymerase subunits  and  ’ Contains 10 smaller subunits, including homologs of  and  Structural features - Thumb - DNA-binding channel - Channel for single-stranded RNA

113. Parallels between initiation pathway in prokaryotes and eukaryotes From Eick et al. (1994) Trends in Genetics 10: 292-296

114. Initiation: Assembly of the PIC 1.TBP component of TFIID binds the TATA box 2.TFIIA and TFIIB bind 3.TFIIF binds RNA polymerase and escorts it to the complex 4.TFIIE and TFIIF complete the PIC

115. initiation

116. Prokaryotes: RNA polymerase –Binds to promoter –Pulls 2 strands apart Eukaryotes: Transcription initiation complex –Transcription factors Proteins Bind to the promoter –RNA polymerase INITIATION

117. Elongation NTPs

118. Elongation

119. RNA polymerase II

120. TERMINATION RNA polymerase meets the terminator Terminator sequence: AAUAAA RNA polymerase releases from DNA Prokaryotes-releases at termination signal Eukaryotes-releases 10-35 base pairs after termination signal

121. polyadenylation

124. Initiation, Elongation, and Termination Helicase activity of TFIIF promotes DNA unwinding Kinase activity of TFIIF phosphorylates RNA polymerase, causing a conformational change in the polymerase that initiates transcription TFIIA, TFIIB, and TFIID (including TBP) remain bound to the promoter to aid in PIC reassembly TFIIH and TFIIE are released Activity of polymerase is enhanced by proteins called elongation factors Termination mechanism is not well understood Polymerase is dephosphorylated and released

125. Enhancers and Silencers The activities of many promoters in eukaryotes are increased by enhancers and decreased by silencers Can be upstream, downstream, or in the midst of a transcribed gene Activators or repressors can bind to enhancers and silencers to influence RNA polymerase binding to promoters Enhancers and silencers act only in cells that contain the appropriate activator or repressor proteins

126. Transcription at Other Promoters RNA polymerase II promoters that lack TATA boxes require several of the same transcription factors that initiate transcription from TATA boxes, including TBP Transcription by RNA polymerase I and RNA polymerase III requires different sets of transcription factors, but TBP is required in all cases Studying transcription initiation is difficult because transcription factors are present at very low concentrations

127. TBP is used by all 3 RNA polymerases TBP is a subunit of an important GTF for each of the 3 RNA polymerases: –TBP or TFIID for Pol II –SL1 for Pol I –TFIIIB for Pol III It does NOT always bind to TATA boxes; promoters for RNA Pol I and Pol III (and even some for Pol II) do not have TATA boxes, but TBP is still used. The GTFs that contain TBP may serve as positioning factors for their respective polymerases.

128. RNA Pol I

129. Signal transduction of Pol I

131. לאיזה מבין מולקולות הרנא יהיה ברצף המתורגם את רצף הפרומוטור ? 1. rRNA 2. mRNA 3. tRNA 4. U1 snRNA

136. Transcription complex

137. קומפלקס האלונגציה

138. transcription

140. polyA-PolII termination

142. Transcription regulation מהלך חיי מולקולאת mRNA

145. Upstream binding factor Upstream control element Transcription associated factor

148. 30 ח. אמינו 2-30 אתרי קישור נקשרים למיגור גרוו משמשים כ TF ציסטאין היסטידין

151. אסטרוגן מופרש ע"י תאי הגרנולוזה ולאחר הביוץ ע"י הגופיף הצהוב

153. a steroid hormonesteroidhormone

154. מדוע תסמיני המחלה משתפרים במוטציה בעמדה -20 בגיל ההתבגרות? 1.עמדה -20 נמצאת באתר הקישור רק לחלבון AR 2.עמדה -20 נמצאת באתר הקישור רק לחלבון HNF4 3.עמדה -20 נמצאת באתר הקישור לשני החלבונים

155. Gene expression

157. Basics of cell biology:development Fertilized egg

158. Basics of cell biology:development Cells differentiation is due to different gene Switches going on and off These cells are different because they express a subset of their 24,000 genes

159. mRNA localization Spector

160. GenePromoter To specify a new cell: place it in the right environment or

161. GenePromoter To specify a new cell: place it in the right environment or Substitute drugs/proteins for environment Mophogens FGF Hedgehog EGF Wnt Retinoic acid HGF

162. Chromosome localization in interphase In interphase, chromosomes appear to be localized to a sub-region of the nucleus. הנוקלאוזומים סביב אזור הפרומוטאר עוברים מודיפקציות נרחבות המיצגות גנים ברמות ביטוי/השתקה. אין החלפה של נוקלאוזום 'ישן' 'בחדש' – פרט לזה שיושב על אזור הפרומוטר. עבודות בשמרים מציעות שאתרי הקישור של ה-TE נמצאים בספיסרים שנמצאים בין נוקלאוזום אחד לשני.

163. Domain opening is associated with movement to non- hetero- chromatic regions

164. Proposed sequence for activation 1. Open a chromatin domain –Relocate away from pericentromeric heterochromatin –Establish a locus-wide open chromatin configuration General histone hyperacetylation DNase I sensitivity 2. Activate transcription –Local hyperacetylation of histone H3 –Promoter activation to initiate and elongate transcription

165. From silenced to open chromatin

166. Movement from hetero- to euchromatin

167. Nucleosoe remodelers and HATs further open chromatin

168. Assembly of preinitiatin complex on open chromatin

169. Transcription factor binding to DNA is inhibited within nucleosomes Affinity of transcription factor for its binding site on DNA is decreased when the DNA is reconstituted into nucleosomes Extent of inhibition is dependent on: –Location of the binding site within the nucleosome. binding sites at the edge are more accessible than the center –The type of DNA binding domain. Zn fingers bind more easily than bHLH domains.

170. Stimulate binding of transcription factors to nucleosomes Cooperative binding of multiple factors. The presence of histone chaperone proteins which can compete H2A/H2B dimers from the octamer. Acetylation of the N-terminal tails of the core histones Nucleosome disruption by ATP-dependent remodeling complexes.

171. Binding of transcription factors can destabilize nucleosomes Destabilize histone/DNA interactions. Bound transcription factors can thus participate in nucleosome displacement and/or rearrangement. Provides sequence specificity to the formation of DNAse hypersensitive sites. DNAse hypersensitive sites may be –nucleosome free regions or –factor bound, remodeled nucleosomes which have an increased accessibility to nucleases.

172. Chromatin remodeling ATPases catalyze stable alteration of the nucleosome II: form a stably remodeled dimer, altered DNAse digestion pattern III: transfer a histone octamer to a different DNA fragment

173. Covalent modification of histone tails N-ARTKQTARKSTGGKAPRKQLATKAARKSAP...- H3 49 1014 18 2327 28 N-SGRGKGGKGLGKGGAKRHRKVLRDNIQGIT...- H4 581216201 acetylationphosphorylationmethylation

174. Yeast SAGA interacting with chromatin