Presentation is loading. Please wait.

Presentation is loading. Please wait.

The Age of Things: Sticks, Stones and the Universe

Similar presentations


Presentation on theme: "The Age of Things: Sticks, Stones and the Universe"— Presentation transcript:

1 The Age of Things: Sticks, Stones and the Universe
Molecular Dating and the Many Kinds of Mammals

2 Proconsul

3

4 WARNING! Astrophysicist talking about Mammalian Phylogeny!

5

6 Non-Placental Mammals
Marsupials Monotremes

7 Rodentia

8 Lagomorpha

9 Chiroptera

10 Carnivora

11 Primates

12 Cetacea

13 Atriodactyla

14 Perissodactlya

15 Xenarthra

16 Hyracoidea Sirenia Proboscidea Dermoptera Tubilentata Pholidota

17 Insectivora Scandentia Macroscelidea

18 Fossil Records of the Different Orders

19 Relationships between the orders derived from morphological characteristics

20 Perhaps orders arose rapidly when the dinosaurs died out

21 Molecular Data Sloth TGCCAAATTAGTTCCGTCATGAGAATGGACTACATGGTCTACTTCAGTTT Hedgehog TGCCAATTCCGTTCTGTTGTGAGAATGGACTACATGGTGTTCTTCAGCTT Sirenian TGCCAATTCCGTTCCGTTATGAAGATGGACTACATGGTCTACTTCAGCTT Elephant TGCCAATTCCGTTCCGTTATGAGGATGGACTACATGGTCTACTTCAGCTT Aardvark TGCCAATTCCGTTCCGTTATGAGGATGGACTACATGGTCTACTTCAGCTT Mouse TGCCACTTCCGTTCCGTGGTCAGTTTGGATTACATGGTCTTCTTCAGCTT Rabbit TGCAAATTCGATTCTGTTATACCCATGGAATACATGGTCTTCTTTAGCTT Human TGCCAATTTGTTTCCGTCATGAGAATGGTCTACATGGTATACTTCAGCTT Flying Fox TGCCAATTCCGTTCTGTCATAAAGATGGACTACATGGTCTATTTCAGCTT Whale TGCCAATTCCGTTCCGTCATGAGGATGGACTACATGGTCTACTTCAGCTT Pig TGCCAGTTCCGTCATGAGGATGGACTGGACTACATGGTCTACTTCAGCTT Horse TGCCAATTCCGTTCTGTTGTGAGCATGGACTACATGGTCTACTTCAGCTT Cat TGCCAGTTCCGTTCTGTCATGACGATGGACTACATGGTCTACTTCAGCTT

22 Chimp Gorilla Orangutan
Human 1.24% 1.62% 3.08% Chimp % 3.12% Gorilla % Human Chimp Gorilla Orangutan

23 All animals do not accumulate mutations at the same rate

24 W X Y Z Time 2 Time 1 Time 0 10 Mutations 10 Mutations 30 Mutations

25 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

26 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

27 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

28 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

29 Accumulates More Mutations
X Y Z W X Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Accumulates More Mutations Time 1 5 Mutations 5 Mutations Time 0

30 Accumulates More Mutations
X Y Z W X Y 40 W X Y Z Time 2 10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 Accumulates More Mutations 5 Mutations 5 Mutations Time 0

31 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

32 Tree Based on Molecular Characters
Tree Based on Morphological Characters Tree Based on Molecular Characters

33

34 Afrotheria Xenartha Euarchonotoglires Laurasiatheria

35 Calibrating the molecular clock
Proconsul Sivapithecus Calibrating the molecular clock Human Chimp Gorilla Orangutan 5 1% Millions of years ago 10 2% Sivapithecus 15 3% Proconsul

36 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

37 X Y Z W 40 50 70 X 30 50 Y 40 W X Y Z Time 2 Time 1 Time 0
10 Mutations 10 Mutations 30 Mutations 30 Mutations Time 1 5 Mutations 5 Mutations Time 0

38 Probability of getting five heads, given the number of Coin Flips
A simpler problem: Flipping Coins Probability of getting five heads, given the number of Coin Flips

39 A simpler problem: Flipping Coins
Probability of getting five heads, given the number of Coin Flips Assumed Probability of each number of Coin Flips

40 A simpler problem: Flipping Coins
Probability of getting five heads, given the number of Coin Flips Assumed Probability of each number of Coin Flips Likelihood the coin was flipped a given number of times

41

42 120 Million Years Ago Eutherians

43 105 Million Years Ago Afrotheria Eutherians Xenarthra and others

44 90 Million Years Ago ? Euarchontoglires Laurasiatheria Afrotheria
Xenarthra

45 Next Time Meteorites and the Age of the Solar System


Download ppt "The Age of Things: Sticks, Stones and the Universe"

Similar presentations


Ads by Google