2. DNA Forensics MUPGRET Workshop

3. “DNA evidence…offers prosecutors important new tools for the identification and apprehension of some of the most violent perpetrators, particularly in cases of sexual assault. At the same time, DNA aids the search for truth by exonerating the innocent. The criminal justice system is not infallible.”Janet Reno

4. Biological Basis The same DNA is found in virtually all cells in our bodies. The four letters of DNA ATCG spell out instructions that give each individual their unique appearance. The arrangement of the letters is different in each individual. ~1 letter per 1000 is different.

6. How Does DNA Carry Information? To answer this question we must take a closer look at DNA. DNA is a biopolymer Polymers are molecules made of repeating units or building blocks DNA has four chemical building blocks symbolized by the letters A,G,C,& T The letters of your DNA are in a specific order that carries information about you!! So, a DNA polymer can be represented as a string of letters: A G C T T A G G G T A A A C C C A T A T A

7. DNA Carries Information in the Sequence of DNA Letters...A G C T T A G G G T A A A C C C A T A G... A gene A gene is a length of DNA letters that contain an instruction for a cell to follow. The cell uses specially designed protein machines to read the information in genes.

8. The Order of DNA Letters Encodes the Genetic Information Example of the DNA letters in a gene: AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG The order or sequence of the A, G, C and T letters in the DNA polymer encodes the actual genetic information The specific order of the DNA letters carries the information. Changing the order of the DNA letters will change the information carried by the gene. We will talk about how this happens later!

9. Secret of DNA Fingerprinting Lies in the Ability to Detect Small Differences in DNA Letters Among Individual Samples Look around the room and see how different we all look. Then compare any two human genomes: The DNA letters are almost the identical order (sequence) between any two human genomes! A very small number (0.1%) of the DNA letters differ between any two human genomes. Two plants that look very similar may be close or distantly related because humans select for desirable traits in new varieties.

10. Genes Can Have Hundreds to Millions of DNA Letters...A G C T T A G G G T A A A C C C A T A G... A gene It can take hundreds, thousands or even a million or more letters (bases) to “spell out” the instructions in a single gene. …and what for?

11. Genes Contain Instructions for Building Proteins Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” Proteins, like DNA, are polymers Protein building blocks are called amino acids Amino acids are strung together into long, linear polymers by following the instructions in genes In general, a gene encodes the instructions for one protein When a gene is “misspelled,” the protein made from it may be made with an incorrect amino acid may not work properly

12. Genetic Code is Written in 3-Letter DNA Words (Codons) CODON MEANINGS: A “START PROTEIN” SIGNAL: AUG A “STOP PROTEIN” SIGNAL: UAA, UGA, UAG An amino acid building block of a protein Codons identified in the Genetic Code Table -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters into the correct amino acid building blocks in the protein chain.

13. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html The Universal Genetic Code Table Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. STOP Codons: UAA UAG UGA

14. A DNA Spelling Mistake Can Alter the Protein Chain ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT STARTADD STOP TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. Spelling MistakeThe DNA “word” TTC is changed to TTT ATG TTT AGG CCA AAT TTT GTC GCG ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain

15. Every Cell Has a Complete Copy of Genome DNA: Virtually every cell in your body contains its own complete copy of all your DNA A single, complete copy of an organism’s DNA is called its genome The genome is a set of instructions, like a master plan, written in a molecular language, using DNA instead of paper and ink But Most of My Cells Don’t Make Melanin-- Right? Therefore, each cell in your body has a copy of your genome, which is, in essence, a master plan for making you.

16. How BIG is 3.2 Billion DNA Letters? Genome Facts: NOVA Online Access Excellence Cell to Chromosome to DNA Human Genome Human Genome Has 3.2 Billion DNA Letters: 3,200,000,000 bp 3.2 billion (3.2 x 10 9 ) is the same as: 200 (1000 pages each) New York City telephone books 3 Gigabyte computer hard drive a person typing 60 words/minute for 8 hours/day, would take more than 50 years to type the entire human genome sequence placed end-to-end the DNA in one human cell extends almost 6 feet One DNA base-pair

17. Variations on the Human Theme! People look very different from each other. Yet we all have features in common, 2 arms, 2 legs, one head, one nose, etc. Our DNA Story

18. Traits are Inherited Traits are characteristics that vary among individuals. Simple trait: Eye color: Blue, brown, green Seed coat color Complex traits: Blood types: A, B, AB, O Plant height. Plant disease resistance. Connection between traits and genes: TRAITS are inherited from parents through GENES!

19. Genes are Responsible for the Traits You Inherit Genes determine: physical traits and influence personality biological characteristics such as blood type level of health risk (heart disease, stroke, alcoholism, Alzheimer’s) specific genetic diseases (sickle cell, hemophilia, cancer, etc.) inherited traits that are passed on to your biological children However: the environment always affects the result of genetic inheritance. Example: genes for growth are influenced by nutrition available during child development

20. DNA forensics Makes use of the similarities and differences in our DNA sequences to determine whether two biological samples come from the same individual or not.

21. VNTR Variable number of tandem repeats. Type of DNA marker that is unique to each individual. DNA of about 80 pairs that is repeated many times in a row. Number of repeats differs between individuals = different size DNA fragments on a gel.

22. VNTR By comparing across multiple VNTR genes we can get a more accurate test of whether two samples are the same or not.

23. Probability One gene has 20 alleles. The probability that two individuals have the same allele is 1/20. If two genes each have 20 alleles and two individuals have the same alleles at both the probability is 1/20 x 1/20 = 1/400.

24. Probability People have two alleles for each gene. If there are 20 alleles for that gene. There are 210 possibile genotypes for that gene. The number of possible combinations at 2 genes with 20 alleles is 210 2, for 4 genes with 20 alleles is 210 4, etc.

25. Marker 1 Marker 2 1 2 3 4 Related 1 & 4 2 & 3

26. Similar DNA Profiles Twins from a single egg have identical profiles. Siblings, parents, and other blood relatives share some alleles in common. The expected proportion depends on how closely related the pair of individuals are.

27. Uses of DNA Profiling Victim identification September 11 Srebrenica Massacre Missing persons Military personnel Paternity Testing

28. Use of DNA Profiling Criminal Testing Conviction Exoneration Excluding suspects Identifying protected species

29. Do matches establish guilt? Not necessarily Must have additional evidence Chain of evidence must be preserved Person may have had reasonable access to the crime scene

30. Advantages of DNA Evidence More sensitive than blood typing More informative More resilient

31. How reliable is DNA profiling? Generally, highly reliable. Reliability is affected by methods used to collect, store and analyze samples. Most common problem is contamination or mixture of a sample. Standards have been established for forensic analysis.

32. CODIS Convicted Offender database Contains for 44,000 DNA profiles in the forensic evidence section. Over 5 million profiles will be entered in the next 4 years. Contributed to matches in more 6000 cases.

33. CODIS Who should be included? Currently convicted offenders are required to be registered in the UK. CODIS rules say only convicted criminals after conviction can be entered but not all states comply with this. Some states submit only certain types of criminals.

34. CODIS Some states allow use for all types of crime investigations. Others only for sex-related or violent crimes.

35. Problems with DNA evidence Evidence can be degraded if not properly handled. Backlogs in processing (16,000 rape cases backlogged in NYC). Contamination Human error

36. Other questions Should tissue samples be saved or destroyed after profiling? Can personal or medical information be obtained from DNA profiles? Why are innocent people convicted of crimes and then exonerated by DNA evidence?

37. More questions Is it possible for an innocent person to be convicted based on DNA evidence? How has DNA evidence changed the criminal justice system?