Presentation is loading. Please wait.

Presentation is loading. Please wait.

Regents Biology 2009-2010 Protein Synthesis Making Proteins.

Similar presentations


Presentation on theme: "Regents Biology 2009-2010 Protein Synthesis Making Proteins."— Presentation transcript:

1

2 Regents Biology 2009-2010 Protein Synthesis Making Proteins

3 Regents Biology  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA

4 Regents Biology  How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA  Cells  Bodies

5 Regents Biology  DNA has the information to build proteins  genes DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work

6 Regents Biology How do proteins do all the work  Proteins  proteins run living organisms  enzymes  control all chemical reactions in living organisms  structure  all living organisms are built out of proteins

7 Regents Biology cytoplasm nucleus Cell organization  DNA  DNA is in the nucleus  genes = instructions for making proteins  want to keep it there = protected  “locked in the vault”

8 Regents Biology Cell organization  Proteins  chains of amino acids  made by a “protein factory” in cytoplasm  protein factory = ribosome nucleus cytoplasm ribosome build proteins

9 Regents Biology Passing on DNA information  Need to get DNA gene information from nucleus to cytoplasm  need a copy of DNA  messenger RNA nucleus cytoplasm ribosome mRNA build proteins

10 Regents Biology mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein

11 Regents Biology DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U : A  C : G  single stranded

12 Regents Biology Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

13 Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

14 Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

15 Regents Biology Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

16 Regents Biology Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

17 Regents Biology protein cytoplasm nucleus trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome

18 Regents Biology How does mRNA code for proteins  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

19 Regents Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa

20 Regents Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon = block of 3 mRNA bases codon ribosome

21 Regents Biology  For ALL life!  strongest support for a common origin for all life  Code has duplicates  several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

22 Regents Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon tRNA UAC Met GCA Arg CAU Val  Anti-codon = block of 3 tRNA bases amino acid

23 Regents Biology mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

24 Regents Biology aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa

25 Regents Biology protein transcription cytoplasm nucleus translation trait

26 Regents Biology From gene to protein transcription translation protein

27 Regents Biology 2009-2010 Whoops! See what happens when your genes don’t work right! Any Questions??


Download ppt "Regents Biology 2009-2010 Protein Synthesis Making Proteins."

Similar presentations


Ads by Google