1. Mechanisms of gene regulation and their relevance to cancer development Diego Villar Cambridge Institute Genetics in the 21st century, The Galton Institute, 30th June 2015

2. Outline (I) Gene regulation and cancer (II) Mechanisms of gene regulation in mammals Transcriptional Post-transcriptional (III) Perturbed gene regulation in cancer Cancer mutations and their effect on gene regulation Relationship between regulatory and mutational landscapes Summary

3. Protein coding information is stored in genes ATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAA TCGCCCGTAGTAATCGCCCG Met Phe Thr Pro Val His Arg Gln ATCGCCCGTAGTACACATGAAATGTAGGCACGTGCCGTTGACGTTT Humans have about 20,000 protein-coding genes DNARNAProtein TranscriptionTranslation

4. DNA Beat together to pump blood Break down toxins and nutrients Move towards bacteria and destroy them One template, different read-outs! [RNA] 1 [Protein] 1 [RNA] 2 [Protein] 2 [RNA] 3 [Protein] 3

5. What makes a cell cancerous? Hanahan and Weinberg, Cell (2011)

6. Hanahan and Weinberg, 2011 Hanahan and Weinberg, Cell (2011)

7. (I) Gene regulation and cancer Each type of cells is restricted to reading certain parts of the genome We call this reading gene regulation (transcription) In cancer the cell is reading/transcribing parts of the genome it would not normally have access to

8. (II) Mechanisms of gene regulation in mammals

9. Protein coding genome (2%) Non-coding genome (98%) Most of the human genome is non-coding … junk DNA?

10. Genes’ Instructions are: (1) often found nearby, and (2) read via protein-DNA contacts ATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAATCGCCCGTAGTACACATGTACTAGATGTACGGGACTACGTTTTAA TCGCCCGTAGTAATCGCCCG Proteins that bind DNA are called transcription factors Just under 10% of human proteins are transcription factors =

11. A basic model for transcriptional regulation Farnham, Nature Reviews Genetics (2009) Transcription factors bind DNA in a sequence-specific manner (10-30 bases in length) Binding occurs at proximal promoters and distant enhancer elements Gene RNA polymerase

12. A basic model for transcriptional regulation Binding of transcription factors recruits regulatory proteins: Enhancer-promoter contacts Favourable chromatin environment (histone modifications, DNA methylation) Increased polymerase activity Promoter Enhancers Farnham, Nature Reviews Genetics (2009)

13. Combinatorial complexity in mammalian gene regulation Roy and Singer, Trends in Biochem. Sc. (2015) Spitz and Furlong, Nature Reviews Genetics (2012)  Hundreds of transcription factors cooperatively bind promoters and enhancers  Transcription factor binding leads to epigenetic modifications in chromatin (histone modifications, DNA methylation)

14. Pervasive transcription of the non-coding genome Protein coding mRNA (2%) Non coding RNA Long ncRNA miRNA piRNA siRNA tRNA Small ncRNA DNARNA

15. Transcriptional and post-transcriptional functions of non-coding RNAs Transcription Processing Esteller, Nature Reviews Genetics (2011) miRNALong ncRNA

16. (III) Perturbed gene regulation in cancer Mutations in protein-coding regions Non-coding cancer mutations

17. Many ‘cancer genes’ are transcription factors P53Most commonly mutated gene in human cancers Twist Metastatic invasion cMycArchetype oncogene HNF1  Liver adenocarcinomas ERBreast cancer driver ARProstate cancer driver ….Numerous fusions of TFs and tissue-specific genes in leukemias and lymphomas Oncogenes and tumour suppressors mutated in cancer

18. Many ‘cancer genes’ directly perturb gene regulation Cancer mutations often occur in proteins regulating modifications of histone tails: Histone methylation and demethylation (e.g. MLL1, EZH2) Histone acetylation (EP300, HDACs) Morgan and Shilatifard, Genes and Development (2015)

19. Emerging cancer therapies target gene regulatory proteins Northcott et. al, Nature Reviews Cancer (2015)

20. What about mutations outside genes? Enabled by whole-genome sequencing technologies Cancer Genome Atlas and the International Cancer Genome Consortium Pleasance et al. Nature (2010)

21. Regulatory landscapes influence a tumour’s mutational spectrum Mutational spectrum of human cancers Gene regulatory landscape of cells of origin Polak et. al, Nature (2015)

22. Summary Cancer is a disease of the genome, in an individual cell type Combinatorial gene regulatory mechanisms result in cell-type specific deployment of the genome Perturbed gene regulation informs many properties of cancer development Gene regulation in the cell-type of origin influences a tumour’s mutational spectrum