1. Investigating Cancer KRAS Activity

2. What is cancer? All cancers derive from single cells that have acquired the characteristics of continually dividing in an unrestrained manner and invading surrounding tissues. Cancer cells behave in this abnormal manner because of changes in the DNA sequence of key genes, which are known as cancer genes. Therefore all cancers are genetic diseases. Human melanoma cell undergoing cell division Credit: Paul Smith & Rachel Errington, Wellcome Images

3. Cancer information One in three people in the Western world develop cancer and one in five die of the disease There are approximately 200 types of cancer, each with different causes, symptoms and treatments In 2007, 297,991 people were newly diagnosed with cancer in the UK An individual's risk of developing cancer depends on many factors, including age, lifestyle and genetic make-up Cancer Research UK http://info.cancerresearchuk.org/cancerstats/incidence/?a=5441 http://info.cancerresearchuk.org/cancerstats/incidence/?a=5441

4. The 20 most common causes of death from cancer, UK, 2008 Cancer Research UK. Accessed July 2010 http://info.cancerresearchuk.org/cancerstats/mortality/cancerdeathshttp://info.cancerresearchuk.org/cancerstats/mortality/cancerdeaths /

5. Cancer cells have altered genomes Karyotype illustrating structural abnormalities in cancer Credit : Mira Grigorova and Paul Edwards, Department of Pathology, University of Cambridge, unpublished Source: www.path.cam.ac.uk/~pawefish/BreastCellLineDescriptions/HCC38.htmlwww.path.cam.ac.uk/~pawefish/BreastCellLineDescriptions/HCC38.html

6. What is a mutation? Germline mutation – A change in the DNA sequence that can be inherited from either parent Somatic mutation – A change in the DNA sequence in cells other than sperm or egg – The mutation is present in the cancer cell and its offspring, but not in the patient’s healthy cells

7. Mutations & cancer genes Cancer genes are causally implicated in oncogenesis Mutations in cancer genes can occur somatically or can be inherited. Mutations in some cancer genes can be inherited from parents, in which case they are present in every cell of the body. Such people are at a higher risk of developing cancer. Somatic mutations can occur in any of the cells of the body except the germ cells (sperm and egg) and therefore are not passed on to children.

8. Importance of somatic DNA changes in human cancer Somatic Inherited Both Only 5 –10% of cancer cases have a clear hereditary component, e.g. BRCA1 and BRCA2 in breast cancer Even in those cases where susceptibility is clearly inherited, somatic changes are required for cancer to develop

9. Cancer genes There are two types of cancer genes: – Tumour suppressor genes – Oncogenes To date, we know of approximately 400 somatic “cancer genes” * but there are almost certainly more to be found COSMIC is a catalogue of somatic mutations found in cancer genes in human tumours and is available at: http://www.sanger.ac.uk/genetics/CGP/cosmic/ http://www.sanger.ac.uk/genetics/CGP/cosmic/ *(COSMIC v47release. July 2010)

10. Tumour suppressor gene TS Cancer These genes normally function to PREVENT cell growth/division

11. Oncogene Cancer Ras Genes which normally function to PROMOTE cell growth/division in a controlled manner

12. Examples of mutations Sequence1Sequence 2Type ACTCGTTAGGCA Substitution ACTCGTTAGGCAACTCGGCA Deletion ACTCGTTAGGCA ACTCGTTATCAGGCA Insertion ACTCGTTAGGCA ACTTTGCAGGCA Inversion ACTCGTTAGGCA Duplication ACTCCTTAGGCA ACTCGTTAGTTAGGCA

13. Cancer progression Benign Tumour In situ cancer Invasive cancer Metastatic cancer Mutations in multiple cancer genes are required for the development and progression of a single cancer

14. www. flickr.com: lastexit External causes of cancer: ultraviolet radiation

15. External causes of cancer: tobacco smoke

16. Lifestyle factor: diet

17. Biological factor: virus HPV is a cause of cervical cancer Proteins from the virus activate and deactivate cancer genes The role of HPV in cervical cancer has led to the development of vaccines HPV in cervical epithelium Credit: MRC NIMR, Wellcome Images

18. Activity The KRAS gene codes for a signalling molecule Mutations in KRAS are present in many cancers, including pancreatic cancer You have to look for the mutations by comparing healthy DNA sequence with tumour DNA sequence Not all of you will find a mutation

19. Your Worksheets

20. If you find a mutation EXAMPLE ONLY

21. How to use the codon wheel Start from the centre and move outwards

22. Mark up your sequence

23. Heterozygous mutations DNA change in cancer Normal DNA sequence BRAF gene mutation Nature 417, 906-7 (June 2002) A double peak indicates a mutation on one chromosome and not the other i.e. a heterozygous mutation T → A A

24. Results Amino Acid Number Healthy DNA Sequence Tumour DNA Sequence Healthy Amino Acid Tumour Amino Acid 12 GGTGTT G (glycine)V (valine) 13 GGCGAC G (glycine)D (aspartic acid) 30GACGAT D (aspartic acid)D (Aspartic acid) 61CAACGA Q (glutamine)R (arginine) 146GCACCA A (alanine)P (proline) 173GATGAC D (Aspartic acid) AminoAcid Number Healthy DNA Sequence Tumour DNA Sequence Healthy Amino Acid TumourAmino Acid 12 GGTGTTGTT G (glycine)V (valine) 13 GGCGACGAC G (glycine)D(asparticacid) 30GACGAT D(asparticacid)D(aspartic acid) 61CAACGACGA Q(glutamine)R (arginine) 146GCACCA A (alanine)P (proline) 173GATGAC D(aspartic acid) D (asparticacid)

25. Significant mutations Amino Acid Number Healthy DNA Sequence Tumour DNA Sequence Healthy Amino Acid Tumour Amino Acid 12 GGTGTT G (glycine) V (valine) 13 GGCGAC G (glycine) D (asparatic acid) 61CAACGA Q (glutamine) R (arginine) 146GCACCA A (alanine)P (proline)

26. How common? AA 12 13,894 AA 13 2,111 AA 61 212 AA 146 33 Source: COSMIC July 2010

27. RB1: tumour suppressor gene Source: COSMIC July 2010

28. How does this affect the KRAS protein?

29. Amino acid 12

30. Amino acid 13

31. Amino acid 61

32. Amino acid 146

34. What’s the impact? KRAS helps to transmit external growth signals to the cell nucleus, driving normal cell growth. It is: – Activated when it binds GTP – Inactivated or “switched off” when GTP is hydrolysed to GDP