1. 1

2. 2 Cloning and Sequencing Explorer Series

3. 3 Why Teach Cloning and Sequencing Series? Students guide the research process and make decisions about their next steps Encompasses a myriad of laboratory skills and techniques commonly used in research Students generate original data that may lead to publications in GenBank Students formulate scientific explanations using data, logic, and evidence Students understand research is a process rather than a single experiment giving students a real-life research experience with both its successes and challenges

4. 4 Appropriate courses Molecular Biology Recombinant DNA Techniques Biotechnology Molecular Evolution Bioinformatics Advanced Cell Biology Advanced Genetics Advanced Plant Biology Independent Research

5. 5 Laboratory Overview Microbial Culturing Antibiotic Selection Sterile Technique Genomic DNA Extraction DNA Precipitation DNA Quantitation GAPDH PCR Nested PCR Degenerate primers Exonuclease Gel Electrophoresis DNA Gel Interpretation Band Identification Standard Curve Use Cloning Direct PCR cloning Transformation Ligation PCR Purification Size Exclusion Chromatography PlasmidMiniprep Restriction Enzyme Digestion Gel Electrophoresis Sequencing Automated sequencing Bioinformatics Sequence Data Editing Contig Assembly Intron-Exon Prediction

6. 6 Student use the following techniques Micropipetting DNA extraction Gel electrophoresis & interpretation Polymerase chain reaction DNA purification Restriction enzyme digests Microbiological sterile technique Preparing competent bacteria DNA ligation Heat-shock transformation Plasmid DNA isolation Sequence analysis BLAST searching GenBank submission

7. 7 Day 1 Day 2

8. 8 DNA Preparation and PCR Amplification of GAPDH Students choose plant tissue Two rounds of PCR –Round 1: Use of degenerate primers –Round 2: Nested PCR Genomic DNA Extraction DNA Precipitation DNA Quantitation GAPDH PCR Nested PCR Degenerate primers Exonuclease Gel Electrophoresis DNA Gel Interpretation Band Identification Standard Curve Use

9. 9 Optional: Dependent on time constraints, analyze samples prior to the next steps. This may include agarose gel electrophoresis, fluorometry, or spectrometry. Optional: If time permits proceed directly to Step 1–2 and set up PCR reactions using freshly extracted genomic DNA. Chapter 1 1: Nucleic Acid Extraction

10. 10 DNA Extraction Use young, fresh plant-tissue DNA extraction at room temperature Time requirement ~30 minutes Does not require DNA quantification

11. 11

12. 12 Benefits of using plants Large number of species Lots of diversity Phylogenetic approaches Avoid ethical concerns associated with animals No pre-approval

13. Nucleic Acid Extraction Quick Guide 13

14. Chapter 2 14 2: GAPDH PCR

15. 15 Optional: Although this protocol recommends analyzing the PCR products after both rounds of PCR have been completed, PCR results can be assessed using electrophoresis directly after this reaction is complete. Positive controls should yield visible bands. It is possible that some plant genomic DNA will not yield a visible band during the initial round of PCR and yet still be amplified after the second round of nested PCR. Note: If this is done — DO NOT add loading dye directly to the PCR reactions as loading dye may interfere with the subsequent round of PCR.

16. 16 PCR Reactions Initial Nested Color-coded PCR primers (hallmark of Bio-Rad PCR kits) Two positive controls Arabidopsis pGAP (plasmid DNA) One negative control

17. 17 What is a Housekeeping Gene? Highly conserved genes that must be continually expressed in all tissues of organisms to maintain essential cellular functions. Examples: GAPDH Cytochrome C ATPase ß-actin

18. 18 Why use GAPDH? Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) Enzyme of glycolysis Structure and reaction mechanism well-studied Multitude of sequences Highly conserved

19. 19 Host Cell Endosymbiotic event Most algae gene duplication Land plants gene duplication Mesostigma (small group of green algae) GAPC GAPAGAPA/B GAPC/CP Gene Families

20. 20 Initial PCR may result in some amplicons that are non-specific Because of the degenerate primer used to amplify the GAPDH of various plant species the initial PCR may also result in some non-specific amplifications

21. 21 Nested PCR amplifies only regions within the GAPDH gene Nested PCR is more specific PCR Animation http://www.bio-rad.com/flash/07-0335/07-0335_PCR.html

22. 22 DNA sequence varies between species Primers need to be designed to account for species variation What if you don’t know the exact DNA target sequence? How do you design primers?

23. 23 Variation in the Genetic Code Introns are less conserved since they do not code for protein Conservative substitution-does not change protein properties The GAPDH enzyme (protein) is highly conserved but there are variations at the DNA level

24. 24 Degenerate primers are used to account for sequence variation

25. 25 Primers are designed using the consensus sequence Tobacco DQ682459 GATTTCGTTGTGGAATCCACTGG Carrot AY491512 GAGTACATTGTGGAGTCCACTGG Blue gem X78307 GAGTACGTCGTTGAGTCGACTGG Tomato AB110609 GACTTCGTTGTTGAATCAACCGG Snapdragon X59517 GAGTATATTGTGGAGTCCACTGG Consensus sequence GABTATGTTGTTGARTCTTCWGG Primer set: GA(GTC)TATGTTGTTGA(GA)TCTTC(AT)GG Yield: 12 primers Reverse primers are designed in the same fashion Plant Accession Sequence GAPDH Number

26. 26 Degenerate primers have optional bases in specified positions To increase the probability that the primer will anneal to the target DNA, variable bases are designed into the primer.

27. 27 Multiple oligos comprise the forward primer GAGTATGTTGTTGA(GA)TCTTC(AT)GG GATTATGTTGTTGA(GA)TCTTC(AT)GG GACTATGTTGTTGA(GA)TCTTC(AT)GG GA(GTC)TATGTTGTTGAGTCTTC(AT)GG GA(GTC)TATGTTGTTGAATCTTC(AT)GG GA(GTC)TATGTTGTTGA(GA)TCTTCAGG GA(GTC)TATGTTGTTGA(GA)TCTTCTGG Position 3 has 3 bases Position 15 has 2 bases Position 21 has 2 bases 3 x 2 x 2 = 12 different oligonucleotides comprising the forward primer

28. 28 DNA Isolation and Amplification To identify differences in GAPDH code we must isolate plant DNA and amplify the gene of interest using PCR first with degenerate primers (primers that account for variation in the DNA code) A second PCR reaction (Nested PCR) is necessary to amplify the region which contains one of the GAPDH gene sequences (second set of primers are nested inside the initial PCR product sequence) Biotechnology Explorer PCR primers are color-coded

29. 29 Setting up initial PCR Reactions

30. 30 Setting up Initial PCR Reactions Protocol 1.Add 20 µl of blue mastermix with initial primers to each PCR tube 2.Add 15 µl of sterile water to each tube 3.Add 5 µl of DNA template to the appropriate tube Control Arabidopsis gDNA Control plasmid DNA Test gDNAs Negative control 4.Amplify in thermal cycler (Annealing temp 52 o C)

31. 31 Results of Initial PCR Reactions 1% agarose gel loaded with (20 µl) initial PCR samples. Green bean and Lamb’s ear gDNA samples generated using Nucleic Acid Extraction module. Lane 1- 500 bp molecular weight ruler (10 µl), Lane 2- PCR of control Arabidopsis gDNA with initial primers (20 µl) Lane 3- PCR of green bean gDNA with initial primers (20 µl) Lane 4- PCR of lamb’s ear gDNA with initial primers (20 µl) Lane 5- PCR of pGAP plasmid control with initial primers (20 µl) Sometimes no amplification is observed with initial PCR with some plants, or much fainter than this gel 500 bp- 1000 bp- 1500 bp- 2000 bp- 12345

32. 32 Use of degenerate primers may not give you an exact match to the target sequence Because there are multiple primers in the mix, the primer concentration for the matching primer is lower than normal (1/12 th concentration) Problems with initial PCR: –inefficient –non-specific Benefits of initial PCR: –cast a wide net –increase the pool of specific products Why is a Nested PCR reaction necessary? INITIAL GACTATGTTGTTGAGTCTTCTGG FORWARD PRIMER Arabidopsis GACTACGTTGTTGAGTCTACTGG GAPC1AT3G04120

33. 33 Exonuclease 1 treatment is needed before the second round of PCR (nested PCR) is done The primers that were not incorporated into PCR product in the first reaction must be removed so that they do not amplify target DNA in the second round of PCR. Exonuclease I will be added to the PCR products The enzyme must be inactivated before proceeding to the nested PCR

34. 34 Exo treatment Protocol 1.Add 1 µl of exonuclease 1 enzyme to the PCR reactions 2.Incubate 15 min 37 ° C 3.Incubate 15 min 80 ° C 4.Dilute 2 µl Exo-treated PCR product in 98 µl water Note: Thermal cycler can be programmed for exo incubations

35. 35 Nested PCR amplifies only regions within the GAPDH gene Nested PCR is more specific

36. 36 Setting up Nested PCR Reactions Protocol 1.Mix 20 µl of diluted exo-treated template DNA with 20 µl of yellow mastermix with nested primers 2.For controls, mix 20 µl of control pGAP plasmid and 20 µl of water with 20 µl of yellow mastermix with nested primers 3.Amplify in thermal cycler (Annealing temp 46 o C)

37. 37 GAPC GAP-C2 GAPCP-1 GAPCP-2 Nested GAPDH PCR product PCR Products Initial vs. Nested Reactions

38. 38 Using Nested PCR to increase your final PCR product There is more PCR product from the nested PCR reactions since there is more specific template DNA to start from Results: intense, bold band on agarose gel DNA template: Genomic DNA DNA template: Initial PCR products Initial PCRNested PCR

39. Chapter 3 39 3: Electrophoresis

40. 40

41. Electrophoresis Quick Guide 41

42. 42 PCR results 1% agarose gel loaded with 20 µl initial PCR samples and 5 µl nested PCR samples. ArabidopsisGreen beanLamb’s earpGAP MW ININININ 123456789 500 bp- 1000 bp- 1500 bp- 2000 bp-

43. 43 Laboratory Overview Microbial Culturing Antibiotic Selection Sterile Technique Genomic DNA Extraction DNA Precipitation DNA Quantitation GAPDH PCR Nested PCR Degenerate primers Exonuclease Gel Electrophoresis DNA Gel Interpretation Band Identification Standard Curve Use Cloning Direct PCR cloning Transformation Ligation PCR Purification Size Exclusion Chromatography PlasmidMiniprep Restriction Enzyme Digestion Gel Electrophoresis Sequencing Automated sequencing Bioinformatics Sequence Data Editing Contig Assembly Intron-Exon Prediction

44. 44 Day 1 Day 2

45. 45 Choose best PCR products for ligation Transformation and selection Plasmid Miniprep preparation Microbial Culturing Antibiotic Selection Sterile Technique Cloning Direct PCR cloning Transformation Ligation PCR Purification Size Exclusion Chromatography PlasmidMiniprep Restriction Enzyme Digestion Gel Electrophoresis PCR Purification, Ligation, Transformation and Plasmid Miniprep Purification

46. Chapter 4 4: PCR Purification 46 Additional tasks to perform prior to next stage: Starter cultures must be inoculated one day prior to the transformation with a starter colony from the HB101 LB agar starter plate. Incubate cultures with shaking overnight at 37oC.

47. 47 Optional: Electrophorese 5 µl of the purified sample along with 5 µl of the unpurified sample on an agarose gel.

48. Column Purification of PCR products 48 SEC is used to purify large PCR products from the smaller primers, dNTPs and enzymes.

49. PCR Purification Quick Guide 49

50. 50 Ligation and Transformation Blunt-end PCR product & ligate to pJet vector Preparation of competent bacteria cells Efficient heat-shock transformation

51. 51 Chapter 5 5: Ligation

52. 52

53. 53 Ligation Sticky End Ligation: If the insert has sticky ends then the vector should be cut with the same enzyme to produce complementary ends Allows for directional cloning (cDNA) Blunt End Ligation: All DNA ends are compatible, not necessary to cut vector and insert with the same restriction enzymes Treating the PCR product with a proofreading DNA polymerase removes 3’-A added by Taq DNA polymerase in PCR, leaving blunt ends ready for ligation.

54. 54 pJet1.2 Blunted Vector 2974 bp in length Designed for blunt-end cloning MCS (Multiple Cloning Site) has restriction enzyme sites may be used for later manipulation High copy number  -lactamase gene for Amp resistance Contains the eco47IR gene

55. 55 Positive Selection The eco471R gene codes for the Eco47I restriction enzyme which is toxic to E.coli. When the eco471R gene is disrupted by the insertion of DNA into the cloning site, the gene will no longer be expressed and the transformed cells will grow on selective media.

56. 56 Possible Ligation Products Expected Results: Self-ligation of vector Ligation of vector with multiple inserts Ligation of vector with primer-dimers or short DNA fragments Self-ligation of insert Ligation of one insert into vector

57. 57 Ligation Quick Guide

58. 58 Chapter 6 6: Transformation

59. 59

60. Transformation Competent cells pGAP plasmid control IPTG Heat Shock Competent Cells are very delicate: keep on ice Bacterial transformation with ligation mixtures is very inefficient (less efficient than transformation with plasmid DNA). Transform with pGAP plasmid as control Isopropyl  -D-1-thiogalactopyranoside (IPTG) is added to the selective medium to artificially increase the expression of the amp r gene and increase transformation efficiency Heat Shock: plating bacteria from ice to agar plates at 37 0 C

61. 61 Transformation Quick Guide

62. 62 Chapter 7 7: Plasmid Purification

63. 63 Plasmid Minipreps Isolate plasmid DNA Restriction digest Electrophorese to confirm inserts

64. 64

65. 65 Picking colonies for plasmid minipreps Each colony is a clonal growth (clones) from one transformed bacteria

66. 66 Plasmid Purification and Restriction Digest Analysis Quick Guide

67. 67 Optional: It is recommended that 5 µl of undigested DNA also be run next to your digested samples. Prepare these samples by combining 5 µl of miniprep DNA with 5 µl of sterile water.

68. 68 2.5 kb > 2.0 kb > 1.5 kb > 1.0 kb > 0.5 kb > Analysis of plasmid digests pJet vector GAPDH inserts Bgl II Digest

69. 69 Example of a miniprep digestion with Bgl II Lane 1: 500 bp molecular weight ruler Lanes 2, 4, 6, 8: minipreps digested with BglII Lanes 3, 5, 7, 9: undigested minipreps Different sizes of inserts suggests different GAPDH genes were cloned in this ligation Inserts can vary from 0.5–2.5 kb depending on plant species 123456789 Digested and undigested DNA were electrophoresed on a 1% TAE agarose gel pJet vector GAPDH inserts

70. 70 Chapter 8 8: Sequencing

71. 71

72. Sequencing Primers, control plasmid and barcoded 96- well plate are included. Actual sequencing service is not included with the purchase of the series. Bio-Rad Laboratories has been working with Eurofins MWG/Operon which is a company that offers sequencing services around the world. We have been able to partner with Eurofins MWG/Operon so that they can offer a highly discounted rate. The benefit of being able to utilize the discounted services of Eurofins MWG/Operon is that their turnaround time is 1-2 days and as an ISO9001 company they adhere to specific quality standards. To contact Eurofins MWG/Operon please visit www.operon.com/bio-rad or call (800)688- 2248. www.operon.com/bio-rad Alternate options for sequencing would include local universities and other professional sequencing services.

73. Sequencing Methods Maxam-Gilbert: Chemical Degradation –5’-end of DNA labeled with a radioactive tag –Labled DNA is divided into 4 test tubes with chemicals which cleave after a particular base –PAGE to seperate cleaved fragments –X-ray film (autoradiography) –Derive DNA sequence from X-ray film image –Limited to about 100 bases Sanger: Chain Termination –Single-stranded template of DNA –Template DNA is divided into 4 test tubes with Sequencing primers DNA polymerase Labled nucleotides (dNTP’s) Modified nucleotide, different dideoxynucleotide (ddNTP) to each reaction tube –Allow for DNA synthesis, when ddNTP is incorporated polymerisation will stop –PAGE and autoradiography can be used to separate and visualize fragment sizes and read sequence

74. 74 Setting up Sequencing Reactions Add sequencing primers to DNA Load 96-well plate Send sealed plate off to chosen sequencing facility for sequencing

75. 75 pJet cloning vector Setting up Sequencing Reactions Always need to sequence reverse, complementary strand GAPDH gene of interest

76. 76 Why use multiple sequencing primers? Typical sequencing reactions yield 500-600 bases of sequence. If the GAPDH insert is longer a single set of sequencing primers will not lead to the full sequence.

77. 77 Automated Sanger method of sequencing 4 fluorescent dyes- 1 for each base DNA fragments separated by CE Fragments separated in sequential order Sequencing

78. 78 Chapter 9 9: Bioinformatics

79. 79 Bioinformatics Two month subscription to genetic analysis software from Geospiza Data is stored on iFinch server Data can be accessed 24/7