Presentation is loading. Please wait.

Presentation is loading. Please wait.

The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Kellye A. Eversole IWGSC Executive Director & The IWGSC Wheat Breeding 2014: Tools,

Published byChastity Simmons Modified over 9 years ago

Similar presentations

Presentation on theme: "The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Kellye A. Eversole IWGSC Executive Director & The IWGSC Wheat Breeding 2014: Tools,"— Presentation transcript:

1 The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Kellye A. Eversole IWGSC Executive Director & The IWGSC Wheat Breeding 2014: Tools, Targets, & Progress Harpenden, United Kingdom 29 January 2014

2 Launched in 2005 on the initiative of Kansas Growers Executive director K. Eversole Sponsors Coordinating Committee General members Co-chairs R. Appels J. Dvorak C. Feuillet B. Gill B. Keller Y. Ogihara The International Wheat Genome Sequencing Consortium

3 Why Lay a foundation to accelerate wheat improvement Increase profitability throughout the industry Vision High quality annotated genome sequence, comparable to rice genome sequence Physical map-based, integrated and ordered sequence

4 Wheat Improvement is Complex  Yield potential and yield stability  Quality of grain and co-products  Adaptation to climate change  Durable resistance to biotic stress

5 Complexity Requires an Integrated Toolbox Training, capacity building -> expertise and critical mass Improved wheat varieties

6  Chromosomes: 605 - 995 Mbp (3.6 – 5.9% of the genome) Dissection of the genome into single chromosomes (arms) Triticum aestivum (2n = 6x = 42) 1C ~ 17,000 Mbp AABB DD  Chromosome arms: 225 - 585 Mbp (1.3 – 3.4% of the genome) D B ; A Doležel et al., Chromosome Res. 15: 51, 2007 Managing the 17 Gb, Hexaploid Genome Chromosome genomics  Chromosome specific BAC libraries and sequencing IEB

7 Faster and cheaper methods to tackle the wheat genome Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI www.genome.gov/sequencingcosts. http://flxlexblog.wordpress.com/2012/12/03/developments -in-next-generation-sequencing-a-visualisation/

8 A sequence for whom & for what purposes Feuillet et al, TIPS, 2010

9 Genes TEs 500 kb BAC by BAC (physical map) BAC by BAC vs WGS Whole genome shotgun √

10 1. BAC library construction 3. Contig assembly by FPC/LTC 4. MTP sequencing /Scaffold assembly 2. BAC fingerprinting (HICF/WGP) GAATTCTTGGTCAGCAATAAGGACAAAGAA GAATTCCTCCTGTGCGGCCGTTTTA GAATTCATGCTCCAGCCAACTCATCCAAAA GAATTCAACAATATAAATATCACCTAAAGC GAATTCCATCAGTATGGAGTTTCTTCATGC GAATTCAAGCTTGAGTATTCTATAGTGTCA GAATTCAATATGTAGAAATTATAGGATGGC GAATTCACCGGAAGGGGTTCCGGGTGTTTC GAATTCCGGAACGCTTCCGGAGACCAAACA GAATTCTGGAATCACTTGATGATGAATCAG GAATTCTGGAGTCTTCCTTTCCGCAGCGAA GAATTCAACGAAATAGTTATGAAATAGAAG GAATTCTGGGGTAACGATGGAATCCTACAC GAATTCTGTCAACGACACTATCATCAGGAA GAATTCTTCGATGCACTGAGTCGCACGGTT GAATTCTTGTGTGAGGTCCGCGTCCTAGAT 5. Pseudomolecule construction (meiotic/LD/RH mapping) 6. Automated and curated annotation IWGSC Strategy for a Reference Wheat Genome Sequence

11 MTP sequencing A reference sequence anchored to the genetic and phenotypic maps Long term Physical mapping of individual chromosomes Short term Gene catalog Virtual order Markers Survey sequencing of individual chromosomes Roadmap to the Wheat Genome Sequence

12 Physical maps Illumina Survey sequences Pseudo- molecules Current status of individual projects

13 IWGSC Chromosome Survey Sequencing Initiative Amplified DNA- sorted individual chromosomes ~50X Illumina sequence >30X Illumina sequence Chromosome arm sequence assemblies Gene modeling, virtual ordering (GZ), annotation, functional, structural analyses Composition and Evolution of the 21 Bread Wheat Chromosomes A, S, D, & AB genomes (7) Read/assembly alignment to chromosome arms

14 Summary IWGSC Chromosome Survey Sequencing - Summary Almost full wheat gene complement identified and allocated to chromosome arms On average, 53% of genes virtually ordered along chromosomes High level of inter- and intrachromosomal duplication Over 3.5 M markers mapped to contigs (1.3M wheat markers + 2.3M SNPs) - SSR, EST, DArT, SNP (90k) markers... 13.2 million SNPs from POPSeq aligned to contigs

15 New phylogenetic analyses of wheat genome evolution Definition of core and pan gene sets for Triticeae by comparing di-tetra- and hexaploid genomes Homoeologue-specific gene expression analyses Wheat haplotype map – E. Akhunov TILLING projects in T. durum and bread wheat – UC, Davis, JIC, Rres Establishment of WheatNet – UC, Davis IWGSC CSS Resources are Facilitating

16 Chr 3B physical map 1,282 BAC-contigs 8,441 BACs 922 pools Pool of 10 BACs (Roche 454 GSFLX Titanium, 8 Kb MP) Sorted chr. 3B (2*108 bp) PE 0.5 kb Illumina (82X) Sanger (2*600 bp) 3B pseudomolecule assembly and analyses 3B SEQuencing Project (~35X) Catherine Feuillet & Fred Choulet

17 An integrated and ordered 3B reference sequence MetaQTL analysis3B consensus map (5000 markers) 3B Physical map 3B pseudomolecule

18 Map-based cloning projects on 3B  Disease resistance genes (Sr, Lr, Yr, Stb…)  Solid stem (saw fly)  Yield  Drought tolerance  Boron transporter  Flowering time  NUE  Chromosome pairing… 40 genes and QTL mapped on 3B  4722 markers on 3B consensus map, 3102 in 964 SC (679 Mb =82 % of the sequence)  13 map-based cloning projects

19 A Breeder’s Perspective Curtis Pozniak 1 year -1 EST marker, not closer - ascertainment bias Xgwm114 XBE200774 XPSP3001 SSt1 Xgpw4513 Xgwm340 Xgwm247 Xgwm181 SSt1 3BL 3 weeks -12 cosegregating markers (SNPs) - no phenotyping in the fields - No ascertainment bias Xgwm114 Xfba217 XBE200774 ctg580 ctg854 Xgwm4703 ctg668 Xwmc274 ctg165 Xgwm247 Xgwm340 Xtam63 Xfba310 Xfba133.2 Xfbb293 Xdarts149 Xgwm181 Xgwm547 Xbarc68.2 Xgpw4513 3B Physical

20 Speed Gene Discovery: Towards Cloning SSt1 2.8 cM Approx. 2.2 Mb 13.3

21 Power of A High Quality Reference Sequence Feuillet et al, Trends in Plant Sciences, 2010; Rey et al, unpublished update) Number of QTLs Cloned Rice Wheat

22 CS WGS 5x (2012) A and D genome related ancestors (2013) CS chromosome survey sequences (2013) CS 3BSEQ (2013) completeness of information 94% real order Wheat Sequences Available Now Gold standard Max 50% using synteny and genetic mapping (GZ): « virtual order » WGS WCS MTP

23 Applications 5X CSAe. tausc hii T. urartu CS CSS MTP based (3B) « blind » SNP marker development xxxx Targeted SNP marker development xx Conversion rate in genotyping for breeding 45%95% Map-based cloning time (years) 10 8 2 Fundamental studies limited to genes complete

24 IWGSC Projects The Annotated Reference Sequence of the Bread Wheat Genome Pseudomolecules (1 of 21 completed) Chromosome Shotgun Sequences and marker alignment (completed) Physical Maps with markers (12 of 21 completed)

25 IWGSC Resources in Breeding Unlimited source of DNA markers for MAS/Genomic Selection Candidate genes for traits = perfect markers Reduce the time and improve the success of resolving QTL Discovery and exploitation of new alleles BAC Libraries Physical Maps Wheat Survey Sequence 3B Sequence Curtis Pozniak

26  272 institutions  40 countries http://wheat-urgi.versailles.inra.fr/Seq-Repository/ All resources accessible at URGI, Versailles Raw sequence reads in the SRA IWGSC CSS assemblies available at URGI and EBI IWGSC CSS assemblies & gene models integrated into EnsemblPlants  52,000 BLAST searches  2.500 downloads IWGSC Resource Access http://plants.ensembl.org/Triticum_aestivum

27 Thank you for your attention! www.wheatgenome.org @wheatgenome

Download ppt "The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Kellye A. Eversole IWGSC Executive Director & The IWGSC Wheat Breeding 2014: Tools,"

Similar presentations

Genomics for Triticeae improvement FP7 European Project.

Genomics for Triticeae improvement FP7 European Project.
Advancing Science with DNA Sequence Maize Missouri 17 chromosome 10 project update Dan Rokhsar 3 October 2006.

Advancing Science with DNA Sequence Maize Missouri 17 chromosome 10 project update Dan Rokhsar 3 October 2006.
Mo17 shotgun project Goal: sequence Mo17 gene space with inexpensive new technologies Datasets in progress: Four-phases of 454-FLX sequencing to max of.

Mo17 shotgun project Goal: sequence Mo17 gene space with inexpensive new technologies Datasets in progress: Four-phases of 454-FLX sequencing to max of.
Analysis of the bread wheat genome using whole- genome shotgun sequencing Manuel Spannagl MIPS, Helmholtz Center Munich Analysis of the bread wheat genome.

Analysis of the bread wheat genome using whole- genome shotgun sequencing Manuel Spannagl MIPS, Helmholtz Center Munich Analysis of the bread wheat genome.
A pseudomolecule of 774 Mb: the 3B experience

A pseudomolecule of 774 Mb: the 3B experience
Mission statement Barley (Hordeum vulgare L.) was one of the first domesticated cereal grains, originating in the Fertile Crescent.

Mission statement Barley (Hordeum vulgare L.) was one of the first domesticated cereal grains, originating in the Fertile Crescent.
Complex Microsynteny among Wheat, Rice and Barley at the Qfhs.ndsu-3BS Region S. Liu and J. A. Anderson Department of Agronomy and Plant Genetics, University.

Complex Microsynteny among Wheat, Rice and Barley at the Qfhs.ndsu-3BS Region S. Liu and J. A. Anderson Department of Agronomy and Plant Genetics, University.
Whole Genome Sequencing &Crop Genetic Breeding Presentation: Wenhui Gao

Whole Genome Sequencing &Crop Genetic Breeding Presentation: Wenhui Gao
FHI Biotechnology Approaches Genome sequencing Clonal testing Transgenics GE trees New varieties Marker-aided breeding.

FHI Biotechnology Approaches Genome sequencing Clonal testing Transgenics GE trees New varieties Marker-aided breeding.
The IWGSC: Building the sequence-based foundation for accelerated wheat breeding Kellye A. Eversole IWGSC Executive Director & The IWGSC Cereals for Food,

The IWGSC: Building the sequence-based foundation for accelerated wheat breeding Kellye A. Eversole IWGSC Executive Director & The IWGSC Cereals for Food,
CS273a Lecture 5, Win07, Batzoglou Quality of assemblies—mouse N50 contig length Terminology: N50 contig length If we sort contigs from largest to smallest,

CS273a Lecture 5, Win07, Batzoglou Quality of assemblies—mouse N50 contig length Terminology: N50 contig length If we sort contigs from largest to smallest,
Structural and Functional Genomics of Tomato Barone et al. 2008 Tomato (Solanum Lycopersicon) – economically important crop worldwide, – intensively investigated.

Structural and Functional Genomics of Tomato Barone et al Tomato (Solanum Lycopersicon) – economically important crop worldwide, – intensively investigated.
Sequencing Status of the Chromosome 8 and New Marker Development toward a Genetic Map Construction between Micro-Tom and Ailsa Craig SOL Genomics Workshop.

Sequencing Status of the Chromosome 8 and New Marker Development toward a Genetic Map Construction between Micro-Tom and Ailsa Craig SOL Genomics Workshop.
Mining SNPs from EST Databases Picoult-Newberg et al. (1999)

Mining SNPs from EST Databases Picoult-Newberg et al. (1999)
Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.

Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.
The Human Genome Race. Collins vs. Venter Collins Venter.

The Human Genome Race. Collins vs. Venter Collins Venter.
Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.

Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College Medical Genomics Course – Debrecen, Hungary, May 2006.

Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College Medical Genomics Course – Debrecen, Hungary, May 2006.
Genetic and physical maps around the sex-determining M- locus of the dioecious plant asparagus Telgmann-Rauber et al. 2007.

Genetic and physical maps around the sex-determining M- locus of the dioecious plant asparagus Telgmann-Rauber et al
Genomics. Gene expression DNA (Genome) pre-mRNA mRNA mRNA (Transcriptome) Proteins (Proteome) Metabolites (Metabolome) Regulation Nucleus Cytoplasm Chromatography.

Genomics. Gene expression DNA (Genome) pre-mRNA mRNA mRNA (Transcriptome) Proteins (Proteome) Metabolites (Metabolome) Regulation Nucleus Cytoplasm Chromatography.

Similar presentations

Ads by Google