1. PCR – Polymerase chain reaction
Lecturer: David

2. Objective
Review DNA replication, knowledge of the process, and how it occurs.
The concept of PCR
The purpose of DNA and RNA extraction relative to PCR.
The process of PCR
the purpose of a primer
Brief background of history of taq and its purpose in PCR

3. DNA replication
Replication allows our genetic material to be passed on to daughter cells.

4. Replication review

5. Replication Overview
Origin of replication
Helicase
SSB
RNA primase

6. Replication Review Leading strand Lagging strand Continuous
Discontinuous
Okazaki fragments

7. PCR is a technique used to AMPLIFY a few copies of DNA exponentially.
What is PCR???
PCR is a technique used to AMPLIFY a few copies of DNA exponentially.

8. Purpose for Amplification
Very small samples can be amplified and analyzed
DNA found at crime scene investigations
Paternity test
Diagnosis (ex. Viral load in HIV)

9. How does it work? You need 5 things: Template DNA Primers
Thermal cycling – increase and decrease the temperature
taq DNA polymerase
dNTPs

10. What’s a primer?
A primer is a sequence necessary for replication, which binds to a target DNA sequence
DNA polymerase requires a primer to begin synthesizing a complementary strand

11. dNTPs Deoxynucleoside triphosphates Triphosphate Sugar – deoxyribose
Nitrogenous base A T C G

12. Thermal cycler Machine used for PCR amplification
Raises and lower temperatures for temperature sensitive reactions

13. Steps for PCR Step 1: Denaturing Heat 94-98°C
Causes the DNA to separate by disrupting the hydrogen bonds between strands

14. Steps for PCR Step 2: Annealing Lower temperature to 50-65°C
Allows primer to bind to DNA strand – H bonding between DNA and primers
One primer binds to 5’ end and one to 3’ end

15. Steps for PCR Step 3: Elongation
Temperature depends on polymerase you use
taq DNA polymerase works best at 75-80°C
Polymerase add dNTPs to primer and extends the strand.

16. The history of taq
Heating inactivates the DNA polymerase used before taq was discovered 
Researchers needed a DNA polymerase that didn’t need replacing after every round of PCR
taq DNA polymerase was discovered in bacteria called Thermus aquaticus that lived in underwater hydrothermal vents

17. taq DNA polymerase!

18. Overview
This cycle of heating and cooling is repeated many times to amplify the amount of DNA.

20. PCR Video

21. Gel Electrophoresis Run product on an agarose gel
Electric current is run through the gel to separate product based on size
Ensures the correct product was amplified

22. Gel electrophoresis
Ladder – DNA solution of varying sizes and used to compare samples
Positive control – a group where you expect an outcome
Negative control – a group where you expect nothing to happen
Larger fragments are closer to the top

23. Questions
What is the purpose of PCR?

24. Answer
To amplify small amounts of DNA

25. Question
What are the 3 steps for PCR?

26. Answer

27. Questions
If your DNA template strand sequence was 5’AGCTAGGCTAACTGCCGGGC 3’, what would your primer sequences be if they were 4 bases long?

28. Answer
3’TCGA5’
5’GCCC3’

29. Questions
Why do we use a taq DNA polymerase?

30. Answer
It can be used at higher temperatures, unlike previous enzymes which denatured at these temperature.

31. Lab today Today you will be doing PCR on a crime scene investigation
2 DNA samples were taken from the crime scene
One was skin
The other is saliva
There are 2 suspects: Trisha Jones, and Neil Burns

32. Lab today You will perform PCR on the DNA samples to amplify it.
The samples will be run on an agarose gel by electrophoresis to compare the DNA found at the crime scene to the suspects.

33. Lab today There will 2 gels per lab. 2-3 groups will run one gel.
Each gel has 8 wells to run samples.

34. Lab today Victim’s DNA Suspect 1 DNA Suspect 2 DNA Saliva Skin
Negative control
Positive control
DNA ladder

35. Lab today
Objective: To understand the importance of PCR and carry out a PCR reaction
Hypothesis: Amplification of the DNA found at the crime scene will match that of the criminal