1. Emily Buckhouse

2. Nitrogenous Bases

3. Nucleosides  Base linked to a 2-deoxy-D-ribose at 1’ carbon Nucleotides Nucleosides with a phosphate at 5’ carbon

4. Phosphodiester Bond  DNA Polymerase

5. Determining the Sequence of DNA  Methods: 1. Chain termination or dideoxy method F. Sanger 2. Shotgun sequence method 3. 2 nd generation sequence methods Pyrosequencing

6. Dideoxy (Sanger) Method  4 Steps: 1. Denaturation 2. Primer attachment and extension of bases 3. Termination 4. Gel electrophoresis

7. Overview: Dideoxy (Sanger) Method 1 4 3 2 Gel electrophoresis 5

8. Dideoxy (Sanger) Method ddNTP- 2’,3’- dideoxynucleotide No 3’ hydroxyl Terminates chain when incorporated Add enough so each ddNTP is randomly and completely incorporated at each base

9. Dideoxy Method Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up

10. Automated Version of the Dideoxy Method

11. So What’s Wrong With It?  The dideoxy method is good only for 500-750bp reactions  Expensive  Takes a while  The human genome is about 3 billion bp

12. Human Genome Project  Began in 1990  Why? Human evolution Nature versus nurture Causes of disease

13. Shotgun Sequencing  Used to sequence whole genomes  Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads StrandSequence First Shotgun Sequence AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA Second Shotgun Sequence AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA

14. 2 nd Generation: Pyrosequencing  Sequencing by synthesis  Advantages: Accurate Parallel processing Easily automated Eliminates the need for labeled primers and nucleotides No need for gel electrophoresis

15. Pyrosequencing  Basic idea: Visible light is generated and is proportional to the number of incorporated nucleotides 1pmol DNA = 6*10 11 ATP = 6*10 9 photons at 560nm DNA Polymerase I from E.coli. pyrophospate From fireflies, oxidizes luciferin and generates light

16. Pyrosequencing  1 st Method Solid Phase ○ Immobilized DNA ○ 3 enzymes ○ Wash step to remove nucleotides after each addition

17. Pyrosequencing  2 nd Method Liquid Phase ○ 3 enzymes + apyrase (nucleotide degradation enzyme) Eliminates need for washing step In the well of a microtiter plate: primed DNA template 4 enzymes Nucleotides are added stepwise Nucleotide-degrading enzyme degrade previous nucleotides

18. Pyrosequencing Method:

19. Pyrosequencing Results:

20. Pyrosequencing Disadvantages  Smaller sequences  Nonlinear light response after more than 5-6 identical nucleotides

21. Summary  DNA sequencing is a common procedure  Dideoxy method Chain termination method Best for small DNA segments  Whole genome shotgun sequencing Sequence human genome Fragments larger DNA strand to manageable chunks  Pyrosequencing Sequence by synthesis Accurate and fast

22. References Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000) Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3 rd ed. Pgs 337- 340. Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, 560-564. Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11. Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467. Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-1145 Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.