Presentation is loading. Please wait.

Presentation is loading. Please wait.

Data Mining Mohammed J. Zaki.

Similar presentations


Presentation on theme: "Data Mining Mohammed J. Zaki."— Presentation transcript:

1 Data Mining Mohammed J. Zaki

2 Traditional Hypothesis Driven Research
Experiment Data Result Design Data analysis

3 Data Data Driven Science No Prior Hypothesis New Science of Data
Process/Experiment Data No Prior Hypothesis New Science of Data

4 Bioinformatics Datasets: Integrative Science Genomes Protein structure
DNA/Protein arrays Interaction Networks Pathways Metagenomics Integrative Science Systems Biology Network Biology

5 Astro-Informatics: US National Virtual Observatory (NVO)
New Astronomy Local vs. Distant Universe Rare/exotic objects Census of active galactic nuclei Search extra-solar planets Turn anyone into an astronomer

6 Ecological Informatics
Analyze complex ecological data from a highly-distributed set of field stations, laboratories, research sites, and individual researchers

7 Geo-Informatics

8 Cheminformatics Structural Descriptors Physiochemical Descriptors
Topological Descriptors Geometrical Descriptors AAACCTCATAGGAAGCATACCAGGAATTACATCA…

9 Materials Informatics

10 Economics & Finance

11 World Wide Web

12 What is Data Mining? The iterative and interactive process of discovering valid, novel, useful, and understandable patterns or models in Massive databases

13 What is Data Mining? Valid: generalize to the future
Novel: what we don't know Useful: be able to take some action Understandable: leading to insight Iterative: takes multiple passes Interactive: human in the loop

14 Why Data Mining? Massive amounts of data being collected in different disciplines Biology, Chemistry, Materials science, Astronomy, Ecology, Geology, Economics, and many more Search for a systematic way to address the challenges across/at the intersection of the diverse fields Leverage the unique strengths of each area Techniques from bioinformatics can be applied to other areas (like network intrusion detection) Game theory from Economics can be applied to problems in CS Database development in Astronomy can help Ecology applications Enable Data-informatics: bio-, chem-, eco-, geo-, astro-, materials- informatics

15 Why Data Mining? Dynamic nature of modern data sets: streams
Massive and distributed datasets: tera-/peta-scale Various modalities: Tables Images Video Audio Text, hyper-text, “semantic” text Networks Spreadsheets Multi-lingual

16 Data mining: Main Goals
Prediction What? Opaque Description Why? Transparent Model Age Salary CarType High/Low Risk outlier

17 Data Mining: Main Techniques
Association rules: detect sets of attributes that frequently co-occur, and rules among them, e.g. 90% of the people who buy book X, also buy book Y (10% of all shoppers buy both) Sequence mining (categorical): discover sequences of events that commonly occur together, .e.g. In a set of DNA sequences ACGTC is followed by GTCA after a gap of 9, with 30% probability

18 Data Mining: Main Techniques
Classification and regression: assign a new data record to one of several predefined categories or classes. Regression deals with predicting real- valued fields. Also called supervised learning. Clustering: partition the dataset into subsets or groups such that elements of a group share a common set of properties, with high within group similarity and small inter-group similarity. Also called unsupervised learning.

19 Data Mining: Main Techniques
Deviation detection: find the record(s) that is (are) the most different from the other records, i.e., find all outliers. These may be thrown away as noise or may be the “interesting” ones. Similarity search: given a database of objects, and a “query” object, find the object(s) that are within a user-defined distance of the queried object, or find all pairs within some distance of each other.

20 Data Mining Process Interpretation Data Mining Transformation
Preprocessing Knowledge Selection Patterns Transformed Data Preprocessed Data Original Data Target Data

21 Data Mining Process Understand application domain
Prior knowledge, user goals Create target dataset Select data, focus on subsets Data cleaning and transformation Remove noise, outliers, missing values Select features, reduce dimensions

22 Data Mining Process Apply data mining algorithm
Associations, sequences, classification, clustering, etc. Interpret, evaluate and visualize patterns What's new and interesting? Iterate if needed Manage discovered knowledge Close the loop

23 Components of Data Mining Methods
Representation: language for patterns/models, expressive power Evaluation: scoring methods for deciding what is a good fit of model to data Search: method for enumerating patterns/models

24 New Science of Data New data models: dynamic, streaming, etc.
New mining, learning, and statistical algorithms that offer timely and reliable inference and information extraction: online, approximate Self-aware, intelligent continuous data monitoring and management Data and model compression Data provenance Data security and privacy Data sensation: visual, aural, tactile Knowledge validation: domain experts

25 Data Science Core Areas
Data Mining and Machine Learning Mathematical Modeling and Optimization Databases and Datawarehousing High Performance Computing Data Compression/Representation Statistics, Algebra, and Geometry Visualization, Sonification Social/ethical/legal Dimensions Application Domains Biology, medicine, chemistry, astronomy, finance, economics, geology, environment, materials, large-scale simulations, national security, WWW

26 Course Topics Exploratory Data Analysis (EDA):
Multivariate statistics Numeric, Categorical Kernel Approach Graph Data Analysis High dimensional data Dimensionality reduction Frequent Pattern Mining (FPM): Itemsets Sequences Graphs Classification (CLASS): Decision trees Naïve Bayes Instance-based Rule-based Discriminant analysis Support vector machines (SVMs) Clustering (CLUS): Partitional Probabilistic Hierarchical Density-based Subspace Spectral Graph clustering

27 Course Syllabus and Schedule
Main Course Page:


Download ppt "Data Mining Mohammed J. Zaki."

Similar presentations


Ads by Google