Download presentation
Presentation is loading. Please wait.
Published byRachel Bennett Modified over 9 years ago
1
An elusive expansion at the FRDA locus Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital
2
Presentation Overview Introduction: Friedreich ataxia: Clinical symptoms; Molecular pathology Case 1: Diagnostic referral; CAG repeat expansion testing; Unusual TP-PCR result Case 2: Diagnostic referral; Premutation plus GAA repeat expansion within the disease-causing size range Case 3: Carrier testing; GAA repeat expansion undetected using standard analysis
3
Friedreich Ataxia (FRDA) Autosomal recessive neurodegenerative disorder; Affects the spinal column and cerebellum; Slowly progressive ataxia of the gait & limbs; Onset: 10 – 15 years of age Associated with: Muscle weakness; Spasticity in the lower limbs; Absent lower limb reflexes; Dysarthria; Scoliosis; Pes cavus; Bladder dysfunction; Loss of position and vibration sense
4
FRDA Additional clinical symptoms: ~ 30 %: Hypertrophic non-obstructive cardiomyopathy ~ 10-25%: Optic atrophy; Deafness; Glucose intolerance or Diabetes mellitus ~ 25%: Atypical presentation: Later age of onset; Retained tendon reflexes; or Unusually slow disease progression
5
Genetics of FRDA Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of ~ 1:100 FRDA gene (Frataxin or X25) indentified in 1996: 1. Expansion of GAA triplet repeat within intron 1 = 98% mutations 5a1423 aaaaaaaaaaaaaaagaagaag aagaagaagaagaaaataaaga Normal alleles: 5-33 GAA repeats; Alleles > 27 repeats rare; Premutation alleles: 34-65 GAA repeats; Expanded alleles: > 66 GAA repeats Some alleles have interrupted sequences: GAAGGA or GAGGAA
6
Genetics of FRDA Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia Carrier frequency of 1:100 FRDA gene (Frataxin or X25) indentified in 1996: 1. 98% mutations = expansion of GAA triplet repeat within intron 1 5a1423 106 2. 1-2% FRDA patients – GAA expansion plus inactivating mutation, (nonsense, splicing, frameshift or missense) Homozygous expansion & compound heterozygous patients: clinically indistinguishable; Patients with missense mutations near the carboxy-terminus have atypically mild FRDA; No patients have been described with two identified point mutations 1 165 182
7
Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers Molecular Genetic Testing
8
Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers n/n (8/29 repeats) n/?
9
Molecular Genetic Testing Detection of GAA repeats: Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers; b) Triplet-prime PCR n E
10
Case 1 Diagnostic referral; Expansion & point mutation analysis requested: Institute of Neurology: GAA repeat flanking PCR; TP-PCR Clinical details: 52 year old female; No further details avaliable
11
Case 1 F-PCR: Patient 1. 31 rpt control 2. Expansion control 3. Hom & Het normal controls 4. & 5. 8 repeats
12
Molecular Genetic Testing Triplet-prime PCR: cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa
13
Triplet-prime PCR: Molecular Genetic Testing cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa
14
Triplet-prime PCR: Molecular Genetic Testing cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa
15
cttcttcttcttcttcttcttcttctt gaagaagaagaagaagaagaa Molecular Genetic Testing
16
Case 1 TP-PCR:
17
Case 1 Modified TP-PCR: Primers: FATP-P3-F-FAM FATP-P1-R FATP-P4-F GAA Int + FATP-P4-F GAG Int
18
Case 1 Southern Blot: Patient Normal E/E n/E 1. 2. 3. 4. EcoRV FA3PEx1
19
Case 1 ? Clinical Significance: Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;
20
Case 1 ? Clinical Significance: Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures; Inhibit transcription = reduced Frataxin protein Interrupted alleles: Triplexes less likely to form; Not predicted to inhibit transcription of Frataxin to the same extent as pure GAA repeats; Shorter in length (equivalent to alleles of 100-300 triplets); May be associated with late on-set disease (GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation alleles; May prevent expansion into abnormal size range Clear guidelines regarding the implications of these interruptions and their clinical significance have not been established
21
Case 1 ? Clinical Significance: Patient: 1 normal allele; 1 interrupted allele; No further mutations identified on sequence analysis Unlikely to be affected with FA; ? chance finding unrelated to the patient’s symptoms Further work: Sequence interrupted allele Detection of interrupted: May be difficult using standard TP-PCR; Requires contiguous run of GAA repeats
22
Diagnostic referral: 53 year old female: Progressive cerebellar degeneration F-PCR analysis identified an allele within the premutation range (~38 rpts); TP-PCR analysis detected the presence of an expansion Case 2
23
Southern blot analysis: Confirmed presence of an allele in the premutation size range & an expanded allele in the affected size range Case 2 Patient Normal E/E n/E 1. 2. 3. 4. EcoRV FA3PEx1
24
Case 2 ? Clinical Significance: Patient: 1 allele within premutation size range; 1 allele within affected size range; Identified in peripheral lymphocytes Premutation alleles: Not thought to affect transcription of the Frataxin gene; Not thought to be pathogenic; May show somatic instability ? if a significant proportion of such alleles expand into the affected size range in appropriate tissues, this may lead to atypical disease; Increases the likelihood of a diagnosis of FA Further work: Testing of other tissue types; Family studies
25
Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction; Two GAA repeat expansions Mother identified as a carrier using standard testing strategy; Southern blot analysis: EcoRV FA3PEx1 Case 3 9.4 Kb - 6.5 Kb - 4.3 Kb - 23 Kb - 1 7 8
26
Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar dysfunction; Mother identified as a carrier using standard testing strategy; Modified TP-PCR Assay: Different locus specific P1-primer; Case 3 Standard TP-PCR Modified TP-PCR Mother Father No expansion detected
27
DNA sequencing: Primers flanking the standard P1 priming site 30bp deletion: Covering the whole of the standard TP-PCR P1 priming site in the patient’s father and the affected child; Deletion present on the same allele as the expansion; Explains why the expansion in the patient’s father could not be detected using standard TP-PCR Summary: Samples harbouring such a deletion would give results consistent with homozygosity for the same size normal allele using these assays; Deletion would not be detected - potentially an expansion could be missed 115 FA referrals with 1 allele in the normal range and no TP-PCR expansion were tested for the presence of this deletion No further deletions were identified in this cohort Likely that such a deletion is either very uncommon or private to this family Case 3 Break point Mother Father Affected child
28
Acknowledgements All within the molecular genetics laboratory Andrew Purvis Mohammed Kiron Kibria Kara Gaffing Fiona Coyne Roger Mountford
29
Thank-you for listening
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.