1. PCR Optimization: Challenges and Successes May 8, 2009 DNA Facility Seminar Series

2. Outline Components of the PCR reaction Components of the PCR reaction Cycling Conditions Cycling Conditions Variations on basic PCR Variations on basic PCR

3. PCR: History PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube. Series of repetitive steps enabling amplification of target DNA from a complex mixture of DNA

4. Starting Thoughts Think about purpose of PCR and downstream applications for your PCR product Think about purpose of PCR and downstream applications for your PCR product Think about “Carry over effect” Think about “Carry over effect” Set up area keeping in mind PCR has the potential sensitivity to amplify a single molecule Set up area keeping in mind PCR has the potential sensitivity to amplify a single molecule

5. Basics Target Target dNTP’s dNTP’s Buffer Buffer Primers Primers DNA Taq polymerase DNA Taq polymerase Denature- 92 0 C-95 0 C (94 0 C) Anneal- 50 0 C-72 0 C Aim for 5 0 C below calculated Tm (52 0 C-58 0 C generally best) Extension - 68 0 C-80 0 C (72 0 C) highest efficiency 70 0 C-80 0 C

6. Template Plasmid Plasmid cDNA (RT-PCR) cDNA (RT-PCR) Genomic DNA Genomic DNA Purified (P) Crude Lysate (C) P C P C Plasmid Genomic 40ng 10ng 1ng

7. dNTPs Mixture of dATP, dCTP, dGTP, dTTP or dUTP Mixture of dATP, dCTP, dGTP, dTTP or dUTP Purity- chemical or enzymatic synthesis Stability- concentration – Li or Na salt form

8. dNTPs Purity can effect PCR Purity can effect PCR

9. Buffer All 10x Buffers are not the same Salt10-50 mM Tris pH 8.3 Salt10-50 mM Tris pH 8.3 Monovalent cation100-150 mM KCl or NaCl Monovalent cation100-150 mM KCl or NaCl Divalent cation1.5uM or > MgCl 2+ Divalent cation1.5uM or > MgCl 2+ Mg2+, Mn2+ Additives Detergent, Glycerol, Gelatin Additives Detergent, Glycerol, Gelatin

10. Buffer Systems Modifications: Mg pH Ionic strength Additives Ionic strength  Mg2+ 

11. Buffer Additives Q-solution-Betaine Q-solution-Betaine DMSO DMSO BSA BSA Glycerol Glycerol Gelatin Gelatin PEG PEG GC-melt GC-melt Formamide Formamide Detergents Detergents Q D B G P Q/D F D

12. Primers Pair complementary to opposite strands Pair complementary to opposite strands 5’  3’ sense primer 5’  3’ sense primer 3’  5’ anti-sense primer 3’  5’ anti-sense primer Features Features 18-26 nucleotidesEqual mix GC to AT bases Match Tm of primersTm o C= 2(A/T) + 4(G/C) 3’ Stability GG or GC clamps

13. Additional Considerations Secondary structure- avoid hairpins, self-dimers, cross- homology Secondary structure- avoid hairpins, self-dimers, cross- homology Avoid di-nucleotide repeats that occur consecutively- ATATATAT Avoid di-nucleotide repeats that occur consecutively- ATATATAT Avoid long runs of single bases- ACGGGGGGAT Avoid long runs of single bases- ACGGGGGGAT Avoid cross-homology- BLAST Test Avoid cross-homology- BLAST Test

14. Primer Variation Example PCR 1 st Round vary primer pairs Sets A-F Forward primers Primer 1: GAGGGCAGATTCGGGAATGTm=60 0 c Primer 2: TCGGGAGAGGCCCTTCCCTm= 62 0 c Primer 3: CAGTTTCCCGGGTTCGGCTm= 60 0 c Reverse primers Primer 1: AGCCTAATCAAGTCACTATCAAGTm=62 0 C Primer 2: GCAAGTGAGAAAATGGGGAG Tm=60 0 C A= Primer 1FPrimer 1R B= Primer 2FPrimer 1R C= Primer 3FPrimer 1R D= Primer 1FPrimer 2R E= Primer 2FPrimer 2R F= Primer 3FPrimer 2R

15. DNA Taq Polymerases Considerations: Aim of experiment Thermal stability Processivity Fidelity

16. DNA Taq Polymerases Standard polymerase works for most applications Standard polymerase with loading dye aids in higher through-put Hot Start polymerase inhibits non-specific primer extension Polymerase blends or cocktails combine polymerases for fidelity with speed Taq blendStandard TaqHot Start Taq

17. Fidelity PCR product sequence PCR product T/A cloned Individual isolates sequenced

18. PCR Cycling

19. Modified PCR Methods Hot Start PCR Hot Start PCR Manual Hot Start Physical Barrier Modified Taq DNA polymerase Oligo Inhibitors Modified dNTP’s Semi-Nested or Nested PCR Semi-Nested or Nested PCR Touch down PCR Touch down PCR

20. Semi-Nested or Nested-PCR Specificity  ----------------------- --------------------  Sensitivity

21. Additional PCR Methods Allele-specific PCR Allele-specific PCR Assembly PCR (PCA) Assembly PCR (PCA) Breakpoint PCR Breakpoint PCR Intersequence-specific PCR (ISSR) Intersequence-specific PCR (ISSR) Inverse-PCR (IPCR or RE-PCR) Inverse-PCR (IPCR or RE-PCR) Ligation Mediated PCR (LM-PCR) Ligation Mediated PCR (LM-PCR) Long distance PCR Long distance PCR Multiplex-PCR Multiplex-PCR Methylation Specific PCR Methylation Specific PCR Mini-primer PCR Mini-primer PCR Quantitative PCR or Real-time PCR Quantitative PCR or Real-time PCR Reverse Transcriptase PCR (RT-PCR ) Reverse Transcriptase PCR (RT-PCR )

22. RT-PCR Quality of RNA Reverse Transcriptase-QC oligo dT random hexamers gene specific primers 

23. Multiplex-PCR Exon 7 and 8 Exon 9 Exon 3 Exon 5 Exon 1 Exon 2 Exon 6 Exon 4 234567819 Increase throughput Increase data with limited material

24. Long-PCR Analyze large area in single reaction Tool to analyze inserts and breakpoints 14kb 3kb 1.6kb 20kb

25. Breakpoint-PCR Isolate low frequency event Isolate low frequency event

26. Inverse-PCR and RE-Inverse PCR Isolate unknown flanking region Isolate unknown flanking region Digest with restriction enzyme Ligate with T4 DNA ligase

27. Real-Time PCR or Q-PCR Increased Sensitivity Increased Sensitivity Increased Specificity Increased Specificity Increased Throughput Increased Throughput

28. Questions