1. Gene Expression and Gene Regulation Part 1
Chapter 9
Gene Expression and Gene Regulation Part 1

2. 9.1 The Link between Genes and Proteins
Archibald Garrod published a paper on the condition of alkaptonuria – he proposed that abnormal phenotypes resulted from biochemical defects or “inborn errors of metabolism”
1941 George Beadle and Edward Tatum firmly established the link between genes, the proteins produced from those genes, and a visible phenotype (won the Nobel Prize in 1958)

3. 9.3 Tracing the Flow of Genetic Information
Production of protein from instructions on the DNA
requires several steps
- Transcription = Production of mRNA
- Translation = Production of protein using mRNA, tRNA, and rRNA
- Folding of the protein into the active 3-D form

4. DNA Transcription pre-mRNA Cell Cytoplasm Nucleus mRNA Translation
mRNA processing
Cytoplasm
Nucleus
mRNA
Figure 9.2
The flow of genetic information. One strand of DNA is transcribed into a strand of mRNA. The mRNA is processed and moves from the nucleus to the cytoplasm, where it is converted into the amino acid sequence of a polypeptide that folds to form a protein.
Translation
Polypeptide
Fig. 9-2, p. 201

5. RNA DNA Adenine (A) Adenine (A) Guanine (G) Guanine (G) Cytosine (C)
Figure 8.7
Nucleotides can be joined together to form chains called polynucleotides. Polynucleotides are polar molecules with a 5′ end (at the phosphate group) and a 3′ end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
Uracil (U)
Thymine (T)
RNA
DNA
Fig. 8-7, p. 183

6. Nucleic Acids DNA RNA Table 10.2
Usually double-stranded 1. Usually single-stranded
Thymine as a bas Uracil as a base
Sugar is deoxyribose Sugar is ribose
Contains protein coding info 4. Carries protein code info
Does not act as an enzyme 5. Can function as an enzyme
Permanent Transient
Table 10.2

7. There are three major types of RNA - messenger RNA or mRNA
Ribose
There are three major types of RNA
- messenger RNA or mRNA
- ribosomal RNA or rRNA
- transfer RNA or tRNA
Figure 8.11
RNA is a single-stranded polynucleotide chain. RNA molecules contain a ribose sugar instead of a deoxyribose and have uracil (U) in place of thymine.
Fig. 8-11, p. 187

8. 9.4 Transcription Produces Genetic Messages
Transcription begins when DNA unwinds and one strand is used as template to make a pre-mRNA molecule
Initiation: Binding of transcription factors and RNA polymerase to promoter region in the DNA
Elongation: RNA polymerase adds nucleotides in 5’  3’ direction
Termination: terminator sequence is reached

9. RNA polymerase, the enzyme that catalyzes transcription
Gene region
5’ Promoter region
RNA polymerase, the enzyme that catalyzes transcription
(a) RNA polymerase binds to a promoter in the DNA, along with regulatory proteins (initiation). The binding positions the polymerase near a gene in the DNA.
Figure 9.3
Transcription of a gene. An enzyme, RNA polymerase, uses one strand of DNA as a template to synthesize a pre-mRNA molecule.
Only one strand of DNA provides a template for transcription of mRNA.
Fig. 9-3a, p. 200

10. Newly forming RNA transcript
DNA template winding up
DNA template unwinding
(b) The polymerase begins to move along the DNA and unwind it. As it does, it links RNA nucleotides into a strand of RNA in the order specified by the base sequence of the DNA (elongation).
Figure 9.3
Transcription of a gene. An enzyme, RNA polymerase, uses one strand of DNA as a template to synthesize a pre-mRNA molecule.
The DNA double helix rewinds after the polymerase passes. The structure of the “opened” DNA molecule at the transcription site is called a transcription bubble, after its appearance.
Fig. 9-3b, p. 200

11. Pre-mRNA must Undergo Modification and Splicing
Transcription produces large mRNA precursor molecules called pre-mRNA
Before leaving nucleus – mRNA is processed
1. 5’ methyl cap added - Recognition site for protein synthesis
2. 3’ poly A tail - Stabilizes the mRNA
3. Removal of introns (intervening sequences- don’t code for protein)

12. Unit of transcription in DNA strand
Exon
Intron
Exon
Intron
Exon
Transcription into pre-mRNA
Cap
Poly-A tail
Snipped out
Snipped out
Figure 9.4
Steps in the processing and splicing of mRNA. The template strand of DNA is transcribed into a pre-mRNA molecule. The ends of this molecule are modified, and the introns are spliced out to produce a mature mRNA molecule. The mRNA is then moved to the cytoplasm for translation.
Mature mRNA transcript
Fig. 9-4, p. 202

13. Alternative Splicing

14. Mutations in Splicing Sites and Genetic Disorders
Splicing defects cause several human genetic disorders
One hemoglobin disorder, b-thalassemia, is due to mutations at the exon/intron region that results in lower splicing efficiency and lower b-globin protein

15. DNA Transcription pre-mRNA Cell Cytoplasm Nucleus mRNA Translation
mRNA processing
Cytoplasm
Nucleus
mRNA
Figure 9.2
The flow of genetic information. One strand of DNA is transcribed into a strand of mRNA. The mRNA is processed and moves from the nucleus to the cytoplasm, where it is converted into the amino acid sequence of a polypeptide that folds to form a protein.
Translation
Polypeptide
Fig. 9-2, p. 201

16. 9.5 Translation Requires the Interaction of Several Components
Translation requires the interaction of mRNA, amino acids, ribosomes, tRNA molecules, and energy sources
mRNA is read in groups of 3 amino acids called codons

17. Codon Chart—20 different amino acids to make all the proteins in living organisms

18. Genetic Code Triplet code (3 mRNA bases = 1 amino acid)
Redundant – more than one codon can specify an amino acid
Unambiguous – each codon codes for just one amino acid
Universal – nearly all organisms use the same code - bacteria, plants, animals

19. Small ribosomal subunit
INITIATION
(a) A mature mRNA leaves the nucleus and enters the cytoplasm, which has many free amino acids, tRNAs, and ribosomal subunits.
mRNA
Initiator tRNA
Small ribosomal subunit
Each amino acid begins with Met, but it is sometimes cleaved or cut off when the final protein is formed.
An initiator tRNA carrying methionine binds to a small ribosomal subunit and the mRNA.
Large ribosomal subunit
Fig. 9-9a, p. 206

20. Transfer RNA (tRNA)

21. (b) A large ribosomal subunit joins, and the cluster is now called an initiation complex.
Figure 9.9
Steps in the process of translation.
Fig. 9-9b, p. 206

22. ELONGATION
A peptide bond forms between the first two amino acids (here, methionine and valine).
Figure 9.9
Steps in the process of translation.
(c) An initiator tRNA carries the amino acid methionine, so the first amino acid of the new polypeptide chain will be methionine. A second tRNA binds the second codon of the mRNA (here, that codon is GUG, so the tRNA that binds carries the amino acid valine).
Fig. 9-9c, p. 207

23. A peptide bond forms between the second and third amino acids (here valine and leucine).
Figure 9.9
Steps in the process of translation.
(d) The first tRNA is released and the ribosome moves to the next codon in the mRNA. A third tRNA binds to the third codon of the mRNA (here, that codon is UUA, so the tRNA carries the amino acid leucine).
Fig. 9-9d, p. 207

24. A peptide bond forms between the third and fourth amino acids (here, leucine and glycine).
Figure 9.9
Steps in the process of translation.
(e) The second tRNA is released and the ribosome moves to the next codon. A fourth tRNA binds the fourth mRNA codon (here, that codon is GGG, so the tRNA carries the amino acid glycine).
Fig. 9-9e, p. 207

25. TERMINATION
(f) Steps d and e are repeated over and over until the ribosome encounters a stop codon in the mRNA. The mRNA transcript and the new poypeptide chain are released from the ribosome. The two ribosomal subunits separate from each other. Translation is now complete. Either the polypeptide chain will join the pool of proteins in the cytoplasm, the nucleus, or will enter the rough ER of the endomembrane system (Section 4.9).
Figure 9.9
Steps in the process of translation.
Fig. 9-9f, p. 207

26. Polysomes
Once a ribosome has started translation, new initiation complexes can form on an mRNA in order to produce many protein molecules.

27. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’
(red = introns)
Mature mRNA:
tRNA anticodons:
Amino acids:

28. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’
(red = introns)
Mature mRNA: AUG AGU CGA UAA
tRNA anticodons:
Amino acids:

29. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’
(red = introns)
Mature mRNA: AUG AGU CGA UAA
tRNA anticodons: UAC UCA GCU AUU
Amino acids:

30. **Mature mRNA: AUG AGU CGA UAA**
tRNA anticodons: UAC UCA GCU AUU
Amino acids:
Methionine,
Serine,
Arginine,
Stop

31. H R Amino group Carboxyl group (a) Amino acid Figure 9.6
(a) An amino acid, showing the amino group, the carboxyl group, and the chemical side chain known as an R group. The R groups differ in each of the 20 amino acids used in protein synthesis. (b) Formation of a peptide bond between two amino acids.
(a)
Amino acid
Fig. 9-6a, p. 203

32. Each amino
acid has a
specific
R-group.

33. 9.7 Polypeptides are Folded to Form Proteins
After synthesis, polypeptides fold into a three-dimensional shape, often assisted by other proteins, called chaperones
Improper folding leads to incorrect protein structure and inability to perform function (Alzheimer, Huntington, Parkinson diseases)
Four levels of protein structure are recognized

34. Four Levels of Protein Structure
Primary structure (1O)
The amino acid sequence in a polypeptide chain
Secondary structure (2O)
The pleated or helical structure in a protein molecule resulting from the peptide bonds between amino acids

35. Four Levels of Protein Structure
Tertiary structure (3O)
The folding of the helical and pleated sheet structures due to interaction of the R-groups.
Quaternary structure (4O)
The interaction of two or more polypeptide chains to form a functional protein

36. Levels of Protein Structure

37. Exploring Genetics: Antibiotics and Protein Synthesis
Antibiotics are produced by microorganisms as a defense mechanism
Many antibiotics affect one or more stages in protein synthesis. For example:
Tetracycline: initiation of transcription
Streptomycin: codon-anticodon interaction
Erythromycin: ribosome movement along mRNA

38. Other topics in Chp 9 Part 2
Protein folding diseases
Regulation of protein synthesis occurs at several levels:
Timing of transcription
The rate of translation
The ways in which proteins are processed
The rate of protein break-down