Download presentation
Presentation is loading. Please wait.
Published bySolomon Wilson Modified over 9 years ago
1
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis
2
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can’t There are infinite combinations of amino acids Can be hundreds or thousands monomers Long These long chains are called polypeptide chains
3
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: – DNA is only found in the nucleus – Proteins are only made outside the nucleus – in the cytoplasm. Houston, we have a problem.
4
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.
5
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.
6
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: – Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) – Contains uracil instead of thymine. – RNA is single-stranded, not double-stranded (usually…)
7
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA)
8
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis Occurs in TWO steps: Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.
9
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Central Dogma This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N
10
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.
11
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/transcription.swf Watch the more complex animation! http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a2.html http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a2.html
12
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT
13
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA
14
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. interon exon An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.
15
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing DNA exon 1 interon exon 2 interon exon 3 pre-RNA (in nucleus) exon 1exon 2exon 3 RNA (in cytoplasm) transcription interon RNA editing
16
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation “ Step Two: Translation “to decode or decipher the meaning of” Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence?
17
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Problem: – There are 20 different amino acids. – There are 4 RNA bases. pheilevalproalahisasnaspcysarg leumetserthrtyrglnlysglutrpgly A T C G
18
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/translation.swf Watch the more complex animation! http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a3.html http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a3.html
19
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
20
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
21
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code
22
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?
23
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code
24
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser
25
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code
26
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser
27
Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL RECAP: DNA is transcribed into mRNA in the nucleus. The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA and amino acids.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.