1. Genetics: The source of variability for evolution How population survival strategies determine human biology and provides the basic background for human variation

2. Diversity of form and function The basis of evolution is variation But, where does variability in biological form and function come from? There are two levels of evolution we will be interested in: Macro-level evolutionary change, the appearance of new species, and Micro-level evolutionary change, the generation by generation changes in the genes of populations.

3. What does the genetic material do, anyway? The genetic material has a number of important functions: 1. Transmit genetic information from one generation to the next (humans produce human infants and not rats or elephants). 2. Since every cell in the body (with several exceptions) has more or less the same genetic material as the original cell (the fertilized egg), the genetic material must be able to reproduce itself when new cells are produced during growth and development as well as normal body maintenance. 3. The genetic materials are organized around a sequence of chemical ‘bases’ that encode for the synthesis of proteins, a huge class of chemicals that perform a wide range of functions in the body.

4. What determines cell structure and function? Proteins that are expressed Unique expression by cell type How is this controlled? Look to the cell nucleus

6. Chromosomes Carries information as part of their structure Name=colored bodies when stained and seen microscopically Species-specific number in each cell nucleus, with the chromosome number usually expressed in pairs (the complexity of the living thing is not reflected in the chromosome number (chimps, for example, have more chromosomes than humans).

7. Human chromosomes Species specific number=46 23 pairs of chromosomes Specifially: 22 pairs of autosomes –or, homologous chromosomes 1 pair of sex chromosomes –XX female –XY male Question: Why are there pairs of chromosomes?

8. Where do the chromosomes come from? We are originally one cell: 23 of maternal origin –ova carry these 23 of paternal origin –sperm carry these If every cell has 46, how do these end up with only 23 and why?

9. Meiosis How many of you remember the process of meiosis well enough to explain it to your classmates?

10. Meiosis

11. If we start out as one cell, how do we get so big and complicated? BIG =cell division (Mitosis) Complicated =cell differentiation

13. Mitosis Cell Division Chromosomal Replication

14. Differentiation Unique proteins in different cell types

15. Proteins: What are they? You are what you eat! Functions include: –Structure –Transport –Immune Function reflects their structure – Proteins have 3 dimensional structure –Folded chains

16. Proteins: Structural specifics Structure: –Three dimensional –Folded chain –Polypeptide chain –of amino acids (aa) –20 common aa Different proteins have different aa sequences

17. Amino acids: What are they and where do they come from? Chemical group based on their composition: an “amine” and an “acid” Of the 20 common aa, –10 the body can make –10 must be eaten (essential aa) Glycine (gly) Glutamic acid (glu) Alanine (ala) Aspartic acid (asp) Valine (val) Isoleucine (Ile) Leucine (leu) Serine (ser) Threonine (thr) Proline (pro) Lysine (lys) Arginine (arg) Glutamine (gln) Aspargine (asn) Methionine (met) Cysteine (cys) Tryptophan(trp) Tyrosine (tyr) Histidine (his) Phenylalanine(phe)

18. Proteins: How they are made: 1. From amino acids Polypeptide chains=aa Sequence of aa crucial to structure, and thus function Sequence determined by series of nucleic acids and the genetic code Determined by a gene valhisleuthraspalaglulys ala val ss cys leu trp gly lys val asn ser asp glu met

19. What is a gene? A “recipe” for a protein Located at a specific region (locus) on a specific chromosome Implications: –different chromosomes carry different information Question: –do homologous chromosomes carry the same information?

20. A gene up-close: is a coding sequence of DNA The relationship between chromosomes and DNA: Chromosomes are packaged DNA

21. DNA Double helix structure Biochemically: –D –Deoxyribose sugar –NA –Nucleic Acids –purines: adenine, guanine –pyrimidines: thymine, cytosine Base pair rules: c g a t

22. Base pair rules illustrated: DNA self-replication

29. Genes and their protein products: How does a gene “code” for a protein? What is the process by which the structure of DNA determines the structure of a protein? For example, how is a piece of coding DNA translated? CCTGAGGAG GGACTCCTC

30. The genetic code 1. Only one strand of DNA is the ‘recipe’, or code The “genetic code” : three sequential nucleic acids specify an amino acid DNA: CAAGTAGAATGCGGACTTCTT AA: val his leu thr pro glu glu

31. Code to Protein: Shuttle system A messenger transmits DNA sequence to protein assembly site –messenger RNA (Ribose Nucleic Acid) distinct from DNA: single strand C G A Uracil –self-assembles as it “reads” the DNA by base- pair rules –goes to ribosome, site of protein assembly

32. Translate this DNA into mRNA: CAAGTAGAATGCGGACTTCTT A. GTTCATCTTACGCCTGAAGAA B. GUUCAUCUUACGCCUGAAGAA

33. The genetic code: codons mRNA: GUUCAUCUUACGCCUGAAGAA GUU CAU CUU ACG CCU GAA GAA

34. M-RNA strand to protein Mirror image of DNA Identifies a sequence of amino acids, and thus a protein HOW Are amino acids gathered together in the correct sequence? The genetic code: A TRANSLATOR molecule t-RNA: 3NA

35. m-RNA meets t-RNA: polypeptide chain of amino acids built mRNA:GUUCAUCUUACGCCUGAAGAAAAG GUU CAU CUU ACG CCU GAA GAA AAG caaguagaaugcggacuu uuc

37. Case Study: Genetics in action at the level of the population Case study: SCA Background: –1912 James Herrick: Case Report Blood smear analysis –1940’s family studies: Mendelian genetics

38. Proteins: Structural specifics Structure: –Three dimensional –Folded chain –Polypeptide chain –of amino acids (aa) –20 common aa Different proteins have different aa sequences

39. Red Blood Cells: What do they do? Origin in bone marrow –120 day life cycle Oxygen-carriers –Pick up oxygen in lungs –Deliver oxygen to body tissues By what mechanism? Rbcsinblood on top half alvertonoutpouch on bottom

40. A Protein! Hemoglobin: Function In red blood cells Transport protein Carries oxygen –How?

41. The function depends on structure: How hemoglobin works Three dimensional Four components: –Two “alpha” chains chromosome 16 –Two “beta” chains chromosome 11 Red marks the spot! –Where oxygen binds –Iron ion critical here Hemoglobin: Structure

42. Sickle Cell Anemia Sickle Cell: –red blood cell shape Anemia: – poor oxygen delivery Cause: –abnormal hemoglobin A genetic disease

43. What causes the sickling? Hemoglobin molecule changes shape Results in distortion of rbc Functional effects?

44. Why does the hemoglobin do this? WHEN: Abnormal hemoglobin molecule unstable under conditions of low oxygen, high acidity HOW: Crystalline structure results WHY? Structural instability

46. Valine Histidine Leucine Threonine Proline Glutamic acid Valine Histidine Leucine Threonine Proline Valine Hemoglobin “S” vs Hemoglobin “A” (Sickle [S] vs Normal [A]) Beta globin gene: –146 amino acids Hbs beta globin chain –one different amino acid –valine replaces glutamic acid at position 6 First 6 amino acids: A S

47. One nucleic acid apart DNA HbA: GGACTTCTT HbS: GGACATCTT ProGlu ProVal Glu

48. Population Frequency of HbS Africa –In some places, 1 in 5 people are carriers, or –HbS/HbA genotype, or heterozygous (hetero=different) –A co-dominant trait: both proteins are expressed Dominant vs recessive? Heterozygote vs Homozygote?

49. Review: At each locus, there are two genes; they are either the same or different. This illustrates allelic variability Homozygote Heterozygote Dominant Recessive

50. HbS and adaptation: In a population of 100 individuals, calculate the number of HbS and HbA genes if 20 % of the people are heterozygotic and the rest are homozygotic normal. What is the percentage of HbS and HbA genes in the population? Why do you think there are no HbS/HbS individuals?

51. Genes vs genotype In 100 individuals genotype genes 20 are HbS/HbA = 20 HbS + 20 HbA 80 are HbA/HbA = 160 HbA 20 HbS 180 HbA 20/200 = 10% HbS and 180/200=90% HbA

52. Why is the frequency of HbS high in some populations?

53. Malaria Disease caused by: Mosquito-borne Parasite –Plasmodium Illness: –fever –rigor –sweats High mortality –very high in infants and children Who survives?

54. Malarial Illness and Parasite Illness intensity related to parasite density –Fewer parasites, less ill Mechanisms to decrease parasites: –kill mosquitoes (DDT) –interrupt parasite lifecycle (anti-malarial drugs) –change the micro- environment of the parasite in the body parasite needs oxygen

55. How to make the body inhospitable for the parasite and increase the likelihood of individual human’s survival Decrease available oxygen to parasite Within limits set by the survivability of the host Red blood cell biochemistry

56. Malaria in Africa Symptoms: –fever, rigor, sweats Disease organism: Parasite: Plasmodium falciparum gambia vivax malariae Vector: Mosquito –Anopheles gambiae vs –Anopheles funestus

57. Natural Selection and the introduction of a new agricultural technique Anopheles funestus populations The possibility for parasite-human contact People contract malaria, & high mortality follows Who survives?

58. Mutants Individuals with traits that are adaptive in the face of parasites: In central Africa, HbS/HbA individuals: Parasites use host oxygen, causing conditions resulting in sickling of red blood cells Anemia is detrimental to parasite survival Parasite numbers decrease, individual improves

59. An example of natural selection

60. Malaria-Sickle Cell Anemia In summary: Human cultural behavior (agriculture) Ecosystem change Malaria Selection for originally rare mutation in hemoglobin: selection favored the heterozygote Specifically, “balanced selection” occurred: 1. People with normal hemoglobin (HbA/HbA) died of malaria 2. People with only abnormal hemoglobin (HbS/HbS) died of anemia 3. Individuals with HbS/HbA genotype lived to reproduce This is an example of differential reproduction/differential mortality

61. Many solutions to the malaria problem In Southeast Asia, the disease thalassemia represents a similar outcome of selection for hemoglobin variants In the Mediterranean, other red blood cell enzyme errors The heterozygote had the advantage

62. To consider: How is it possible that there are these diverse solutions to the same problem? How would you expect the gene frequency of the HbS gene in the United States today to compare with what it was two centuries ago?

63. Many ways to make the body inhospitable to the parasite Red blood cell biochemistry

64. Populations gene pools: unique and adaptive Reflect reproductive success in local environments Small, isolated populations Different random mutations may become successful by chance genetic driftThis reflects genetic drift

65. How are new genes introduced into populations? By people! Migration into and out of populations: people take their genes with them This is an example of gene flow For example, the relative frequency of HbS in the populations of African descent in the United States has decreased in the past two centuries as a result of intermixture with other populations.

66. Concepts you should know and understand after our discussions: I. Basic Genetics The differences between chromosomes, gene, allele How cell division occurs Meiosis DNA, RNA and the process of protein synthesis How mutations, recombination, translocation effect this Codon The relationship between nucleic acid, amino acid, protein The human karyotype: autosomes, sex chromosomes

67. Concepts you should know and understand after our discussions: II. How genetics works in populations The specific case of sickle cell anemia: –An example of a mutation that became advantageous to a population –The specifics of the mutation, the structure and function of hemoglobin, how it affects the red blood cell, and the effects for the individual The selective pressure of malaria: –The nature of the disease, the organism that causes it, how it is contracted by people; how they survive it. Why did malaria and sickle cell anemia evolve together in a human population? –An example of balanced selection How genetic mutation, natural selection, genetic drift and gene flow effect a population’s gene pool

68. Genetics and the evolution of human diversity