1. Structure and Study of Macromolecules

2. DNA
transcription
mRNA (4%)
functional RNAs (96%)
translation
Proteins

3. DNA
All prokaryotic and eukaryotic genomes consist of DNA. (Some viruses have RNA genomes, e.g influenza viruses.)

4. DNA (deoxyribonucleic acid)
DNA is a polymer built of deoxyribonucleotides:

6. Polymerization of deoxyribonucleotides into DNA
is catalyzed by DNA polymerase:
Speed of synthesis in replication ≈ 2000 nucleotides/sec.

7. DNA in cells can be (relatively) short or long,
single- or double-stranded,
linear or circular.
Examples of genome organization:
Species
Genome
Size
Number of genes
Parvovirus
Single-stranded linear DNA
1.6 kb 5
Phage M13
Single-stranded circular DNA
6.4 kb 10
E. coli
Double-stranded circular DNA
4,600 kb
4405
H. sapiens
chromosome 21
Double-stranded linear DNA
47,000 kb
584
Note that the gene density in the genomes of viruses and bacteria (e.g. E. coli) is much higher than in the human genome.

8. 3D-structure of DNA
Double helix composed of single strands that run antiparallel. Structure is stabilized by hydrogen bonds between the purine and pyrimidine bases and by base stacking (hydrophobic interactions between the bases).

9. Right- and left-handed DNA helices

10. 3D-structure of DNA
Interior of DNA is hydrophobic. DNA is water-soluble because of the sugar-phosphate backbone that interacts with water molecules. Disrupting this interaction, e.g. by addition of salts and alcohol, will precipitate DNA.

11. Hydrogen bonds stabilize DNA double helix

12. Hydrogen bonds Weak bonds between a positively
charged donor hydrogen atom and a negatively charged acceptor atom
Very important in interactions of macromolecules, e.g. protein-protein interactions, DNA-protein interactions, etc.
Strength is ≈ 5-30 kj/mol, about one tenth of a covalent bond.

13. Hydrogen bonds in DNA

14. van der Waals forces Weak attractive forces induced in atoms
that are close to each other.
Strength of van der Waals forces about 1/10 of hydrogen bonds.

15. DNA strands can be separated (denatured) by
breaking the hydrogen bonds
Heat and OH- ions (alkali) can break H-bonds
Tm, the melting temperature at which 50% of the DNA strands are separated. Tm is sequence-dependent. A GC-rich sequence has a higher Tm than an AT-rich sequence.

16. 3D-structure of DNA
The sequence of the bases in the interior of the double helix is accessible through the major and minor grooves without opening the double helix. Important for specific binding of DNA-binding proteins.

17. Hydrogen bond acceptors and donors in the major
and minor grooves of DNA
A, acceptor; D, donor; H, non-polar hydrogen; M, methyl group

18. 3D-structure of B-DNA
Besides B-DNA there is also A- and Z-DNA that occurs naturally.

19. B-DNA is the predominant form of DNA in cells but not the only form
Structure of DNA is flexible and depends on the sequence of nucleotides. Large stretches of Gs and Cs promote formation of the left-turning Z-DNA.

21. DNA is associated with proteins to form chromatin
DNA is not naked in cells. It is always associated with proteins. Protein-DNA complexes are called chromatin.

22. Closed circular DNA is normally wound around itself (supercoiled).
Supercoiling is brought about by topoisomerases (catalytic activities of topoisomerases will be explained in the lecture about replication). DNA can be negatively or positively supercoiled. Supercoiling is required for efficient transcription and replication in bacteria.
Linear DNA molecules can wind around proteins and become topologically stressed.

23. The degree of DNA supercoiling can be determined by
specific techniques and visualized by agarose gel
electrophoresis.
relaxed ccDNA
linearized ccDNA
moderately
supercoiled ccDNA
highly supercoiled ccDNA

24. DNA RNA mRNA rRNA tRNA snRNA snoRNA microRNA siRNA ribozymes Protein
synthesis
Processing
of rRNA
Catalysts
Splicing
of mRNA
Regulation of gene expression

25. DNA
RNA
Contains uracil (instead of thymine in DNA)
Sugar-phosphate backbone contains
ribose (instead of deoxyribose in DNA)
tRNA

26. Differences between DNA and RNA
2’ hydroxyl group
Uracil instead of
thymine

27. RNA is synthezised by RNA polymerases
RNA polymerases: 3 different enzymes in eukaryotes, 1 enzyme in bacteria, 1 enzyme in mitochondria. RNA polymerases involved in priming DNA synthesis in replication of DNA.

28. RNA can fold back on itself to form double helices
G-U base pairing is possible.

29. RNA secondary and tertiary structures
Pseudoknot
Tetraloop

30. tRNA secondary and tertiary structures

31. RNA secondary structures can be predicted
Quickfold
5’- cgggauguagcgccagcuugguagcgcaugugcuuugggagcauagggucgcagguucgaauccugucaucccga -3’
G-U base pairing is possible.

32. DNA RNA mRNA rRNA tRNA snRNA snoRNA microRNA siRNA ribozymes Protein
synthesis
Processing
of rRNA
Catalysts
Splicing
of mRNA
Regulation of gene expression

33. Examples of ribozymes

34. RNase P activity
RNA
protein
tRNA

35. DNA
mRNA
Proteins

36. Proteins Catalysis Enzymes Structure Cytoskeleton Hair Nails
Contraction
Actin
Myosin
Storage
Seed proteins
Regulation
Activators
Repressors
Protection
Antibodies
Toxins
Transport
Hemoglobin

37. Proteins are synthesized by polymerization of amino acids
Proteins consist of 50 to hundreds of amino acids, having molecular weights of a few thousand to a few hundred thousand dalton. Polypeptides have a direction, an N-terminus and a C-terminus. Synthesis of proteins proceeds from the N-terminus to the C-terminus.
General structure of
an L-amino acid
Peptide bond formation

38. The 20 common amino acids specified by the genetic code
Besides those 20 amino acids selenocysteine and pyrrolysine are found in proteins. Pyrrolysine only in archaebacteria.

39. Structural organization of polypeptide chains

40. Rotations are possible around the C-N and C-C bonds of peptide bonds

41. a-helices and ß-sheets are common secondary structures of proteins
These structures are stabilized by hydrogen bonds. These structures depend on the amino acid sequence of the polypeptide chain. Proline, for instance, disrupts alpha-helices.
a-helix
ß-sheet

42. Examples for proteins consisting mostly of a-helices and ß-sheets
a-helix
ß-keratins:
fibers of spiders and silkworm,
claws, scales, and beaks of
reptiles and birds.
a-keratins:
hair, wool, skin, horns, nails

43. 3D-folding of polypeptide chains is stabilized by:
Hydrogen bonds
Disulfide bonds (covalent)
Ionic (+ -) interactions
Hydrophobic interactions
van der Waal’s interactions
Alpha-helices and ß-structures are linked by random conformations (linkers and hinges). Certain areas of a polypeptide chain may fold independent of the rest of protein. These areas are called protein domains. Certain domains are found in different proteins that have different function.
Note: in cells correct folding of proteins is promoted by chaperones and chaperonins.

44. Proteins can have sequence and structural motifs
HTH-motif is found in many bacterial and eukaryotic DNA-binding proteins that regulate transcription (repressors and activators of transcription). The zinc finger motif is particularly common in many eukaryotic DNA-binding proteins. Eukaryotic genomes can code for hundreds of different zinc-finger proteins.
Note that the dimensions of an alpha- helix fit perfectly into the major groove of B-DNA.
Many other protein motifs are known that bind to DNA or RNA. Note that the motifs are just a small part of a protein (for example, HTH motif just 20 amino acids).
Helix-turn-helix motif
Zinc finger motif

45. Protein domains
Protein domains are larger than motifs They fold independently of the rest of the protein. The same domain may occur in proteins that have different functions.