1. Restriction Enzyme Digestion & Southern Blotting of DNA

2. Experiment Goals Digestion of DNA by restriction enzyme
Analyze digested DNA by electrophoresis
Transfer digested DNA to nitrocellulose filters (Southern blotting).

3. Restriction Enzymes
Restriction enzymes are endonucleases which catalyze the cleavage of the phosphodiester bonds within both strands of DNA.
They require Mg+2 for activity and generate a 5 prime (5') phosphate and a 3 prime (3') hydroxyl group at the point of cleavage.
The distinguishing feature of restriction enzymes is that they only cut at very specific sequences of bases,
Often the recognizes sites are palindromic.
N is the length of the genome and b is the restriction site length.

4. Restriction enzyme
The enzyme EcoRI cutting DNA at its recognition sequence
Different restriction enzymes have different recognition sequences.
This makes it possible to create a wide variety of different gene fragments.

5. Restriction Enzyme
There are hundreds of different REs from different microorganisms.
Each RE cuts DNA at a specific “recognition sequence” of nucleotides. Examples:
EcoRI-- GAATTC;
AluI -- AGCT
Restriction enzymes are traditionally classified according to the subunit composition, cleavage position, sequence-specificity and cofactor requirements.

6. Naming of Restriction enzymes
Restriction enzymes are named according to the organism from which they are isolated.
This is done by using the first letter of the genus followed by the first two letters of the species.
Only certain strains or sub-strains of a particular species may produce restriction enzymes.

7. Restriction Enzyme Uses
Recombinant DNA technology
Cloning
Replicates a sequence inserted into a host cell
DNA restriction mapping
A rough map of a DNA fragment
DNA fingerprints
Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single recombinant molecule.

8. A restriction enzyme requires a specific double stranded recognition sequence of nucleotides to cut DNA.
Recognition sites are usually 4 to 8 base pairs in length.
Cleavage occurs within or near the site.
Both DNA strands in the site have the same base sequence when read 5' to 3'. Such sequences are called palindromes.

9. HinfI Restriction Enzyme
Recognition Site:

10. Restriction enzyme is part of the cell’s restriction-modification system in bacteria.
The phenomenon of restriction modification in bacteria is a small scale immune system for protection from infection by foreign DNA.
Bacteria can protect themselves only after foreign DNA has entered their cytoplasm.

11. Unit Determination Assay
One unit of restriction endonuclease is defined as the amount of enzyme required to digest one microgram of the appropriate substrate DNA completely in 60 minutes under the conditions specified for that enzyme.

12. Set up of a restriction enzyme reaction
A RE reaction contains the DNA to be analyzed,
A restriction enzyme,
A restriction enzyme buffer mix.
contains a buffering agent to maintain constant pH,
and Mg++ (from MgCl2) as a necessary cofactor for enzyme activity.

13. Digestion by Restriction Enzyme
Measure the DNA concentration
Use the Nano-drop spectrophotometer to measure the concentration of DNA, this is used to determine the amount of HinfI restriction enzyme to be used.
Digestion of DNA
Mix the following components in a clean microtube.
Mix gently and spin down for a few seconds.
Incubate at 37°C for 16 hours.
Component Volume
nuclease-free water 16 μl
10X Buffer R μl
DNA (0.5-1 μg/μl) μl
HinfI (10 u/μl) μl *

14. Analysis of DNA digestion
Analyze products on 2% agarose gel containing ethidium bromide.
Samples are prepared with loading dye and then loaded on the gel.
Visualize the PCR product on UV transilluminator.

15. Electrophoresis of Genomic DNA
Odd numbered lanes contain undigested genomic DNA
Even numbered lanes contain digested genomic DNA
Undigested DNA is represented by a sharp band near the wells of the gel, while smearing indicates digested DNA sample.

16. Southern Blotting

17. Southern Blotting
A technique used in molecular biology to check for the presence of a particular DNA sequence in a DNA sample.
The amount of DNA needed for this technique is dependent on the size and specific activity of the probe.

18. Uses of Southern Blotting
Identify mutations, deletions, and gene rearrangements
Used in prognosis of cancer and in prenatal diagnosis of genetic diseases
Diagnosis of Leukemia's
Detect variations in gene structure
Identify homologous genes among different species

19. Principle
The Southern Blot takes advantage of the fact that DNA fragments will stick to a nylon or nitrocellulose membrane.
DNA molecules are first elctrophoresed and then transferred from an agarose gel onto a membrane.
The membrane is laid on top of the agarose gel and absorbent material (e.g. paper towels or a sponge) is placed on top.

20. With time, the DNA fragments will travel from the gel to the membrane by capillary action as surrounding liquid is drawn up to the absorbent material on top.
The membrane is now a mirror image of the agarose gel.

21. Performing Southern Blotting
DNA Digestion with an appropriate restriction enzyme.
Gel Electrophoresis run the digest on an agarose gel.
Denature the DNA (usually while it is still on the gel).
Transfer the denatured DNA to the membrane (blotting)
Preparing the probe
Hybridization Probe the membrane with labeled ssDNA.
Detection Visualize your radioactively labeled target sequence.

22. 2- Gel Electrophoresis 1- DNA Digestion
Cut the DNA into different sized pieces.
HinfI restriction enzyme is used.
2- Gel Electrophoresis
Load digested samples onto agarose gel (typically 0.8 to 1.0% agarose).
Run gel at maximum rate of 5 volts per cm.

23. 3- Denature the DNA
DNA is then denatured with an alkaline solution such as NaOH.
This causes the double stranded to become single-stranded.
Only ssDNA can transfer.

24. 4- Blotting Transfer the DNA from the gel to a solid support.
The blot is usually done on a sheet of nitrocellulose paper or nylon (a positively charged nylon membrane ).
Transferred by either electrophoresis or capillary blotting.
used. Nitrocellulose typically has a binding capacity of about 100µg/cm, while nylon has a binding capacity of about 500 µg/cm. Many scientists feel nylon is better since it binds more and is less fragile.

25. 4- Blot Fixation The blot is made permanent (constant) by:
Drying at ~80°C
Exposing to UV irradiation

26. 5- Preparing the probe
It is a fragment of DNA of variable length (usually bases long), which is used to detect in DNA the presence of nucleotide sequences that are complementary to the sequence in the probe
Must be labeled to be visualized
Usually prepared by making a radioactive copy of a DNA fragment.
Probing is often done with 32P labeled ATP, biotin/streptavidin or a bioluminescent probe.

27. 6- Hybridization
Hybridization-process of forming a double-stranded DNA molecule between a single-stranded DNA probe and a single-stranded target patient DNA.

28. 6- Hybridization Steps for hybridization
1. The labeled probe is added to the matrix incubated for several hours to allow the probe molecules to find their targets
2. Any unbound probes are then removed.
3. The place where the probe is connected corresponds to the location of the immobilized target molecule.

29. probes 3’ – *ATCTCGGGAATC – 5’ add probe hybridization
5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’
* ATCTCGGGAATC

30. 7- Detection Visualize your labeled target sequence.
If radiolabeled 32P probe is used, then you would visualize by autoradiography.
Biotin/streptavidin detection is done by colorimetric methods.

31. Steps in Southern Blotting
DNA extraction
Disease gene
Fragments of
DNA appear
as a smear
DNA digestion
Gel electrophoresis
Paper towels
Chromatography
paper support
Denaturation of patient’s DNA in gel
Gel in
NaOH
Nylon filter
Southern blot
Gel
This process takes ~8 days
10x SSC
Blot dismantled
Autoradiography
X ray film
Hybridisation:
Stringency washes
Radioactive probe
added to filter
cassette
filter
filter

33. Southern Blot of same DNA (final result on x-ray film)

34. Advantages and Disadvantages of Southern Blotting
The exact location of a disorder does not need to be known
Disadvantages
They are rather time consuming
Needs high quality/quantity DNA Radioactive

35. Animation