Download presentation
Presentation is loading. Please wait.
1
of Microbial Communities
Metagenomics of Microbial Communities Scott Sproule Cam MacMillan Daniel Hann
2
Outline Context A brief history of microbiology
A brief history of genomics Defining metagenomics Metagenomics - Transcending genomics Accurate diversity measurements Two approaches of metagenomics Sequence based approach Function based approach Environmental analysis - Marine - Soil Applications of Metagenomics Industrial Agriculture & Renewable Energy Environmental remediation Life sciences Conclusion
3
Context
4
Microbiology: Perspective
Date Contributor Contribution 1703 Robert Hooke Observed Cells 1677 Antonie van Veeuwenhoek Observed microbes 1776 Edward Jenner Vaccine 1862 Louis Pasteur Germ Theory 1875 Ferdinand J. Cohn Classification of Bacteria 1881 Robert Koch Bacteria & Disease 1928 Frederick Griffith Transformation 1950’s Jonas Salk Advances in cell culturing 1963 Jacob & Monod Operon concept 1973 Cohen, Chang, Helling, & Boyer Plasmids as vectors 1986 Kary Mullis Polymerase chain reaction Exciting research in genomics currently revolves around patterns of gene expresion
5
Main Techniques Microscopic Techniques Culturing Techniques
Direct observation Combine with - Staining Isotopes Flourescence Growing Isolation Examination Manipulation experimentation Inconsistent estimates of diversity and organisms numbers
6
Accounting for Inconsistencies
“The Great Plate Count Anomaly” How much were they missing? What were they missing? Why were they missing it? It was clear that there were many viable cells that could not be cultured
7
“Unculturability” Environmental Nutritional factors Signaling factors
Essential factors Artificial reproduction difficult Bacteria Specific requirements Competition Community structure Defense mechanisms “Can we culture the unculturable?
8
Genome Common all living things on earth A universal language
An instruction manual A toolbox A record of history Genomics has changed the way we view ourselves the world world around us
9
Genomics the study of whole genomes Nucleotides DNA Genes Genomes
10
History of Genomics Date Contributor Contribution 1858 Darwin
Natural selection 1865 Mendel Genetic inheritance 1941 Beagle and Tatum One gene, one enzyme 1944 Avery, MacLeod, & McCarty DNA genetic material 1946 Lederberg & Tatum Bacterial recombination 1953 Watson & Crick Double helix 1969 Bell laboratories UNIX 1974 Cerg & Kahn TCP protocol 1977 Sanger Sanger sequencing 1982 GenBank Online database 1990 Altshul BLAST 1995 Venter & Celera Corp Shotgun sequencing Exciting research in genomics currently revolves around patterns of gene expresion
11
Genomics Today Rapid sequencing of whole genomes
The pinnacle of genomics? Metagenomics transcends genomics Multiple genome level
12
Metagenomics Meta-analysis – combination of separate analysis
Genomics – analysis of an organisms genetic material
13
What is metagenomics? Study of the collection of microbial genomes or genome fragments through direct extraction A culture independent technique that can provide meta-analytic level information about: Population structure Genetic Diversity Functional elements Novel genetic material A synthesis of a number of fields: Molecular Genetics Microbiology Bioinformatics Population Genetics Computer science
14
Applying Metagenomics to Microbial Communities
Traditional methods of quantifying microbial diversity Sample environments independently Isolate each species through culturing techniques Characterize through biochemical & sequencing techniques Realistic? Very labour intensive Time estimate: 100’s of years Incredibly expensive $$$$$$ Most organisms can not currently be be isolated through culture
15
Microorganisms Are Everywhere!
16
Scratching the surface
We live in a world dominated by microorganismsHowever, very little is known about the role they play in our environment. One of the main questions that remains to be answered is how these microorganisms compete and communicate between themselves to get nutrients and produce energy in an ecosystem. To address this question, one has to overcome the limitations associated with the ‘uncultivability’ of at least 99% of the microorganisms in nature
17
Tools of Metagenomics Cloning techniques PCR
Cutting edge sequencing techniques Bioinformatics Open source databases Genbank Protein Database TreeBASE Genbank - creates public database and tools for analyzing genome data PDB protien database tools and resources for protiens for relating structure structures of protiens, TreeBASE – database phylogenic information
18
Growth of GenBank Steep hill to climb!
GenBank - “An annotated collection of all publicly available nucleotide and amino acid sequences.” --NCBI Founded: 1982 Shotgun Sequencing: 1995 Doubling every 18 months! Steep hill to climb!
19
Approaches to metagenomics?
Metagenomics = Blue center (overlaps the three fields) Can be used in combination of all three fields to assay environmental samples
20
Questions for metagenomics
21
Analysis Two main approaches Sequence driven - What genes are there (2) Function driven - What the genes do
22
Metagenomic Process Sequence driven approaches Functional driven
Determine what the genes are Sequence driven approaches Data collection Relies on conserved DNA Phylogenic analysis Used to measure biological diversity Extract DNA Determine what the genes do Three approaches: Screen a metagenomic lib for a phenotype then attempt to determine its phylogenetic origin Screen clones from a specific phylogenetic anchor ex 16S rRNA Sequence entire metagenome & search for interesting genes and phylogenetic anchors Functional driven approaches Functional screening Can identify novel genes Relies on gene expression Proteins
23
Sequence-Based Approach
Sequencing was one of the main driving forces behind the development of metagenomics
24
Sequencing One way to classify metagenomic fragments
Relies on nucleotide diversity analysis Discriminate between species Seq. A GACTACGATCCGTATACGCACA--GGTTCAGAC || ||||| ||||||||||||| ||||||||| Seq. B GAATACGAGCCGTATACGCACACAGGTTCAGA Requires use of online databases Ex: BLAST in GenBank Compares “unknown to known” One of the approaches allowing the classification of metagenomic fragments is the sequence-composition-based method. It relies on the analyses of oligonucleotide frequencies that vary significantly among genomes, permitting discrimination of different species
25
✔ ✖ ✔ ✖ ✖ ✔ Restrictions Whole Genome Sequenced
Genomics Metagenomics ✔ ✖ Whole Genome Sequenced ✔ Know Species of Origination ✖ However, environmental sequencing comes with its own restrictions especially when compared to normal genomic sequencing In single organism genomics practically all of the microbe's genome is sequenced, providing a complete picture of the genome. We know from which species the DNA or RNA originated After assembly, the location of genes, operons, and transcriptional units can be located and identified May be some errors but can properly annotate those areas of the genome that are deciphered ✖ Many DNA elements Identified ✔
26
Sequence Metagenomics
Not necessary to determine species of origin Obtain large volume of data ~ Less redundant Fragment’s = 20bp – 700bp Assembled sequence reads don’t exceed 5000 bp In contrast, the sequences obtained from environmental genomic studies are fragmented. Each fragment was obviously sequenced from a specific species, but there can be many different species in a single sample, for most of which a full genome is not available Short sequence reads that are dissociated from their original species can be assembled to lengths usually not exceeding 5,000 bp; consequently, the reconstruction of a whole genome is generally not possible. In addition to being fragmented and incomplete, the volume of sequence data acquired by environmental sequencing is several orders of magnitude larger than that acquired in single organism genomics 9
27
Random Shotgun Sequencing
1. Library construction 3. Assembly 2. Random Sequencing Phase Automated pyrosequencing DNA a. assemble sequences a. isolate DNA b. close gaps b. fragment DNA c. clone DNA VECTOR ACTGTTC ... After cloning and metagenomic library constructed you can use high throughput automated pyrosequencing Shorter fragments then sanger sequence however this limitation is compensated by the larger number of sequence reads Misassemblies are caused by the presence of repetitive DNA sequences that make assembly especially difficult because of the difference in the relative abundance of species present in the sample C. edit sequence 4. Annotation And Publication Missassemblies?
28
Random Sequencing Objective
To estimate bacterial biodiversity ~ Species Richness Identify 1000’s of prokaryotic, viral & eukaryotic species Mass amounts of genomic data obtained Does not depend on PCR Put sequence in computer BLAST Studies in: Sea water Soil microbial mats Dead whale carcass Feces etc. Organism level (microbiome) Microorganisms are Everywhere! In each study, environmental samples were obtained and the microbial DNA was extracted directly from the sample, sheared, cloned into Escherichia coli, and random clones were sequenced. Species Richness is a measure of the number of species in a sample
29
Sequence Specific: Phylogenic
Look at evolutionary relationships Phylogenetic studies look at tracking evolutionary relationships between organisms (2). So metagenomics as it pertains to phylogeny is comparing genetic sequences of unidentified, unculturable bacteria to that of known, culturable ones, in order to come to a conclusion about the evolutionary origins of the unculturable bacteria Phylognetics measured by building evolutionary trees and summing up the total length of branches in such trees
30
16S rRNA Key Challenge What to look for?
Analysis based on evolutionarily conserved marker sequences Want High conservation across species Slight & measureable changes over millions of years primers or probes based on conserved sequences identifies homologues of known genes. 16S rRNA
31
16S rRNA Value Vital for translation Essential Short
Conserved within a species Different between different species Very slow mutation rate Species Concept Sequence based arbitrary ~ Consensus: ~97% identity = species Changing all the time if difference between 16S rRNA sequences is more than 3% → two sequences are from different species (or “operational taxonomic units” or “phylotypes”)
32
Screen for 16S rRNA sequence
Extract DNA Construct clone library Ex BAC cloning Screen using sequence specific primers When desired fragment is found Sequence & compare universal primers + PCR to amplify 16S rRNA genes from community DNA separate the different DNA sequences These differences or similarities in the rRNA sequence can then be looked at between organisms in sequence alignment software to determine how close there evolutionary origins are → construct phylogenetic tree Alignment represents a hypothesis
33
Function Based Approach
34
Functional Approach: Overview
Sample DNA sheared Transformation Plasmid vector Functional screening Genomic DNA extraction
35
DNA Extraction and Isolation
Aspects of Sample Removal of contaminants Cell purification DNA Isolation & Restriction Digest For now the order goes from top left in U shape Blender Centrifugation Cell lysis
36
Cloning & Transformation
Random Fragments cloned into expression vectors Expression vectors transfected into broad expression hosts
37
Plasmid Expression vectors
Talk about 3 things here. Resistance gene, origin of replication, and multiple cloning site. Specific plasmid vectors for different things you want to do etc….
38
Functional Screening
39
Treasure Hunting Looking for novel genes Biological tool boxes
Detergents Proteases Lipases Esterase’s Antibiotics Novel antibiotics Not synthetic Mutate the antibiotics
40
Marine Metagenomics - Microbes = 90% of marine biomass
Microbes account for 90% of the earths biomass and mediate biochemical cycles of the ocean and responsible for 98% of primary production in the sea. Without them many life forms would cease to exist. It is of no wonder that the sea is a hotspot for metagenomic studies. - Microbes = 90% of marine biomass - 98% of Primary Producers in Sea % are cultivable
41
Craig Venter Ocean Exploration
most famous for his role in being one of the first to sequence the human genome and for his role in creating the first cell with a synthetic genome in 2010 Founded celera genomics Led Global Sampling Expedition Craig Venter
42
7.7 million sequence reads 44 different samples 41 sites
Ocean exploration genome project in aims of assessing the microbial diversity of marine microorganisms 7.7 million sequence reads 44 different samples 41 sites Surface water at 320km intervals collected 7.7 million sequence reads from a total of 44 different samples from 41 sites most samples were collected from the surface water marine environment at about 320km intervals the level of the organism, the goal is to sequence as many genes, in their entirety, as possible from these ecologically rich environments Catalog genes belonging to communities of microbes Made information freely available
43
Sampling Metadata Site Metadata Location (lat/long, water depth)
Site characterization (finite list of types plus “other”) Site description (free text) Country Sampling Metadata Sample collection date/time Sampling depth Conditions at time of sampling (e.g., stormy, surface temperature) Sample physical/chemical measurements Reference:
44
Sample Collection Determine physical characteristics of sample site
Salinity, pH, depth, dissolved O2, temperature Filtered & storage Characterize Genetic Material DNA Isolation Constructing a Library Automated Sequencing Metagenomic Analysis Check characterstics of water at site location Experiments simple take sea water and filter it and collect different sized organisms and take DNA back to lab where 100 million letters of genetic code are sequenced every 24 hrs Discovered photorecpetors that use sunlight for energy.
45
Discoveries First twelve hours in Sargasso Sea Six million new genes
Tripled the number of known prokaryotes on earth Six million new genes 1.3 million new genes species from single site Tens of thousands of new protein families 782 rhodopsin-like photoreceptors Previously only found in Archaea Unexpected links between genetics & environment Different rhodopsin proteins in open ocean vs coast line Better understanding of key biological processes? New ideas for alternative energy production? Solutions to deal with climate change? Discovered proteorhodpsins that use sunlight for energy. From one site discovered 1.3million new genes and new species Saw tremendous diversity at each site Difference in warm and cold temperature waters This study revealed that the blue and green variants are found in different environments with blue light preferred in the open ocean and green light preferred in coastal environments Researchers believe these data will lead to better understanding of key biological processes which could eventually offer new ideas for alternative energy production and could offer solutions to deal with climate change and other environmental issues.
46
Components Combined set of online databases ex NCBI. The eukaryotes make up the largest portion and is more than twice that of bacteria Predicted kingdom proportion of sequences from GOS assigned using the BLAST search scheme
47
Soil Metagenomics Soil is very diverse Nutrients Moisture pH Organic
Oxygen Temperature Surface vs. Subsurface Elusive Poor recovery rate Nuclease Cell bias to lysis techniques Different methods yield dramatically different estimates of diversity and organism number
48
Soil Diversity Soil is very diverse Nutrients Moisture pH Organic
Oxygen temperature 40X more diverse than marine The number of prokaryotic species found in a single soil sample exceeds the number of known cultured prokaryotes Estimates:
49
Soil Requires more Complicated Approach
Variability in Extraction Methods Accounting for different extraction methods How much are we still missing?
50
Other Metagenomic Hot Spots…
Wastewater Whale Carcass Human Gut Feces
51
Applications of Metagenomics
Now what does all this science mean for business and society? “The metagenome provides a potentially inexhaustible genetic resource for biomolecules of potential utility in a variety of industries”
52
Applications of Metagenomics
Metagenomics offers potential solutions to some of the most complex medical, environmental, agricultural and economic challenges of today Biotechnological potential of uncultivated bacteria might be accessible by directly cloning DNA sequences retrieved from the environment Information on why certain organisms are unculturable Culture these organisms Discover novel Pathways
53
Industrial Applications
Novel enzymes rare through culturing Novelty: Avoid infringing on a competitor’s intellectual rights Bacillus Protease Novo Hundreds of variations with a single AA substituted Enzymes are vital for many different industries and their sales are estimated at $2.3 billion in 2003. Food applications, detergents, textiles, agriculture, pulp/paper and other chemicals Access to novel enzymes has been limited to the small number of cultivable bacteria. This leads to having to design a process to accommodate a mediocre enzyme. (leading to suboptimal reaction conditions) With Metagenomics it becomes possible to search through uncultivated microbial diversity to find a better natural suitable enzyme that fits process requirements Avoid infringing on competitor’s intellectual rights by finding a superior enzyme with an entirely new sequence (detergent industry) Enzymes are vital for many different industries and their sales are estimated at $2.3 billion in Food applications, detergents, textiles, agriculture, pulp/paper and other chemicals. Ample demand for new enzymes and biocatylists (overview of biotechnology industry). Metagenomics is the most likel technologies to provide the candidiate molecules required
54
Industrial Applications
Search for the “Ideal” bio-catalyst Temperature pH Pressure Speed Turnover
55
Environmental Remediation
Environmental Contamination Toxic metals Fossil fuels Chemicals Xenobiotics Microorganisms can interact with contaminants Oxidize Bind Transform Immobilize Metagenomic searches for genes & proteins involved Picking on Alberta: Tar Sands
56
Agriculture Detecting diseases in livestock, crops and other products
Soils rich in microbial communities. Communities very complex, poorly understood and their intimacy with crops means they are of economic importance nutrient cycling, nitrogen fixation, sequestering metals Understanding soil composition Enhanced farming 1 gram of soil has estimated 10^9-10^10 microbial cells
57
Renewable Energy Produce energy sources such as hydrogen and methane
Typically derived from biomass sources Cellulose and other non-edible parts of plants transformed into biofuels Transform cellulose into usable ethanol, methanol Ex: Cellulosic ethanol Produce energy sources such as hydrogen and methane Capture and store these by-products Metagenomics approaches for new, efficient ways of producing energy sources *cellulose (agricultural waste) Several microorganism work together to do this (cellulose to sugars) and then the subsequent fermentation of those sugars to ethanol
58
Renewable Energy Ex: Bio- Alcohols, Bio-Diseases, Oils, etc….
Searching mircobial communities for biomolecules that can be used as energy Looking in unlikely places Cow Rumen: Cellulose digestion Methane Cleaner methane Metagenomic analysis for compounds involved in this reaction The world’s reliance on non-renewable energy (that’s fossil fuels) is not sustainable. We are at the mercy of changing political climates due to our dependence on these sources. Greenhouse gases produced from these sources also lead to global warming. The solution might just be microorganisms. Ex: Bio- Alcohols, Bio-Diseases, Oils, etc….
60
Human Health The microbiome: The relationship between the human body and the microbial communities will lead to new methods for diagnosing, treating and preventing diseases Being used to sequence the microbial communities from ~18 body sites from 250 individuals to determine if changes to the human microbiome can be correlated with human health. Drugs from microbe-derived compounds: Look for function metagenomics searches 2) *(part of human microbiome initiative) 3) Case researchers have transplanted gut microbial communities from obese mice into leaner relatives. The result? Their leaner relatives gained more fat. What does this mean? The caloric value of the food we eat may vary according to gut microbe composition.
61
Metagenomic Approach to Microbiome
Microbiome very influential to human health What do know know about the microbiome? Metagenomic approach tells us not very much Comparing microbiome of healty and non. Healthy Microbiome transplants?
62
Future Directions New enzymes, antibiotics, and other reagents identified More exotic habitats can be intently studied Can only progress as library technology progresses, including sequencing technology Improved bioinformatics will quicken library profile analysis Investigating ancient DNA remnants Discoveries such as phylogenic tags (rRNA genes, etc) Learning novel pathways will lead to knowledge about the current nonculturable bacteria to then learning to culture these systems Point 5. Like cave bears and mammoths Pont 6. Will give momentum to the growing field Potential to substantially affect industrial production An oil sample might contain 10^4 different bacterial species Different industries are interested in exploiting the resource of uncultured microorganisms
63
Conclusion
Similar presentations
