1. Computational Molecular Biology Biochem 218 – BioMedical Informatics 231 http://biochem218.stanford.edu/ http://biochem218.stanford.edu/ Simple Nucleotide Polymorphisms (SNPs) Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy)

2. Frequency of SNPs in the Human Genome mutations Simple

3. SNPs & InDels in HuRef Autosomes

4. 2007 Scientific Breakthrough of the Year

5. Single (Simple) Nucleotide Polymorphisms (SNPs) SNPs are used for identification and forensics SNPs are used for mapping and genome-wide association studies of complex diseases SNPs are used for estimating predisposition to disease SNPs are used for immigration & citizenship in the UK SNPs are used to predict specific genetic traits SNPs are used for classifying patients in clinical trials GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT

6. Orchid Cellmark Ltd. http://www.cellmark.co.uk/ http://www.cellmark.co.uk/

7. A SNP Primer at NCBI http://www.ncbi.nlm.nih.gov/About/primer/snps.html http://www.ncbi.nlm.nih.gov/About/primer/snps.html

8. Department of Energy (DOE) SNP Page http://www.ornl.gov/sci/techresources/Human_Genome/faq/snps.shtml http://www.ornl.gov/sci/techresources/Human_Genome/faq/snps.shtml

9. Simple Nucleotide Polymorphisms (SNPs) Most SNPs are genetically neutral o Forensics o Paternity tests o Immigration in the United Kingdom o Follow ethnic migrations o Clinical trials However SNPs can reflect distinguishing characteristics o Predisposition to disease o Insurability and employment => GINA, December 7, 2009 o Often the basis for discrimination or other stigma Some variations cause disease. Unlike SNPs, these variations are usually very rare. SNPs can serve as genetic markers for other traits o Clinical trials associate SNPs with drug efficacy o Clinical trials associate SNPs adverse drug reactions o Consumer genomics associate SNPs with many other traits  23andMe, Navigenics, DNADirect 23andMeNavigenicsDNADirect

10. Carrier Frequency of Cystic Fibrosis Alleles http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=cf http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=cf

11. Carrier Frequency of Gaucher’s Alleles http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=gaucher http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gene&part=gaucher

12. Eric Green’s View of SNPs (Director of NHGRI)

14. Types of SNPs http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp Noncoding SNPs o 5’ UTR o 3’ UTR o Introns o Intergenic Regions o Pseudogenes o Regulatory  Splicing  Transcriptional regulation (promoter & TF binding sites)  Translational regulation (initiation or termination)  Regulatory miRNA target sites Coding SNPs o Synonymous SNPs (third position variation) o Replacement SNPs (change Amino acid)  Functional SNPs (acceptable amino acid replacement)  Non-functional SNPs (traits & diseases)

15. Human Promoter SNPs © Gibson & Muse, A Primer of Genome Science

16. Human Beta Hemoglobin Gene http://www.ncbi.nlm.nih.gov/gene/3043?ordinalpos=3&itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum

17. Human Beta Hemoglobin Gene SNPs

18. Beta-hemoglobin GeneView in dbSNP

19. One  -Hemoglobin SNP

20. GeneView of One  -Hemoglobin SNP

21. Diversity of One  -Hemoglobin SNP

22. SNP Variation Viewer

23. OMIM SNP Variations

24. dbSNP at NCBI http://www.ncbi.nlm.nih.gov/SNP/ http://www.ncbi.nlm.nih.gov/SNP/

25. Origin of Haplotypes © Gibson & Muse, A Primer of Genome Science

26. Linkage Disequilibrium and Recombination Rate © Gibson & Muse, A Primer of Genome Science

27. Linkage Disequilibrium (LD) Across the Human LPL Gene © Gibson & Muse, A Primer of Genome Science

28. Recombination hotspots are widespread and account for LD structure 7q21 © Gibson & Muse, A Primer of Genome Science

29. Recombination hotspots are widespread and account for LD structure 7q21 © Gibson & Muse, A Primer of Genome Science

30. Observation of Haplotypes © Gibson & Muse, A Primer of Genome Science

31. SNPs in Populations © Gibson & Muse, A Primer of Genome Science

32. Sequence and Distance-Based Phylogenies (evolutionary trees) Sequence-Based Methods (Parsimony) o Assigns mutations to branches o Minimize number of changes o Topology maximizes similarity of neighboring leaves Distance-based methods o Branch lengths = D(i,j)/2 for sequences i, j o Distances must be metric o Distances can reflect time or number of changes o Distances must be relatively constant per unit branch length

33. © Francis Collins, 2008

34. International HapMap Project http://www.hapmap.org/ http://www.hapmap.org/

35. International HapMap Project http://www.hapmap.org/ http://www.hapmap.org/

36. International HapMap Project http://www.hapmap.org/ http://www.hapmap.org/

37. International HapMap Project http://www.hapmap.org/ http://www.hapmap.org/

38. International HapMap Project http://www.hapmap.org/ http://www.hapmap.org/

39. Thousand Genomes Organization http://www.1000genomes.org/ http://www.1000genomes.org/

40. Thousand Genomes Organization http://www.1000genomes.org/ http://www.1000genomes.org/

41. 10,000 Genomes Project Evolutionary Biology http://www.genome.gov/ http://www.genome.gov/