1. GENETICS AND POLITICS Benedicte Callan Sid Richardson Fellow LBJ School, Center for Health and Social Policy LBJ School, CHASP 1

2. TALK OVERVIEW 1. The OECD 2. Genetics & Genomics 3. The controversies 4. OECD “solutions” 5. Under what conditions do countries establish international soft law for research and health policy? 2 LBJ School, CHASP

3. The Organisation for Economic Cooperation and Development’s 30 member countries LBJ School, CHASP 3

4. MEMBER COUNTRIES Meet in specialist committees and Ministerial level annual meetings to: Share policy experience Develop and publish comparable data Identify principles of good governance Do peer reviews of performance and policies Agree multilateral instruments 4 LBJ School, CHASP

5. OECD STRUCTURE 5 LBJ School, CHASP Council Oversight and strategic direction Representatives of member countries and of the European Commission Committees Discussion and implementation Representatives of member countries and of countries with Observer status work with the OECD Secretariat on specific issues Secretariat Analysis and proposals Secretary-General and Private Office Directorates Annual budget: 336 million euros funded by member countries

6. BIOTECHNOLOGY UNIT Committee on Scientific and Technology Policy Working Group on Biotechnology Task Force on Biomedicine an Health Innovation Task Force on Industrial Biotechnology Task Force on Biological Resource Centres Focuses on the application of advances in the life sciences to a variety of industrial sectors and their implications for society… 6 LBJ School, CHASP

7. OECD MINISTERIAL MANDATES in RESEARCH & HEALTH: What policies will help capture the potential health benefits from genetics and genomics? Can we do so while addressing the concerns of society about these new technologies. 7 LBJ School, CHASP

8. WHAT IS GENETICS AND GENOMICS? Genetics The roles and functions of single genes and variants Genomics The study of whole organism genomes: their sequence, genetic mapping, interactions between loci and alleles within the genome. Pharmacogenomics The use of genetic data to inform drug development and testing. An important application of pharmacogenomics is correlating individual genetic variation with drug responses. 8 LBJ School, CHASP

9. HUMAN GENOME PROJECT (1990-2003) 9 LBJ School, CHASP Genetic map:Polymorphic landmarks to trace inheritance Physical map: Clones covering all chromosomal regions Sequence: DNA sequence (3 billion bases) Gene List: Identification of all genes 20-25,000 genes Information freely available without restriction From Eric Lander, June 2009

10. SEQUENCING THE HUMAN GENOME The Human Genome Project took 13 years and cost $3 billion Recent costs of sequencing genome about $100 - 250,000 per genome New techniques (SMRT, nanopores) bring costs closer to $50,000 and sequence time down November 6 announcement of whole-genome sequences at cost of $4,400 NIH push to deliver the >$1000 sequence, to allow personal sequence data to be used routinely in medical care 10 LBJ School, CHASP

11. Slide from Eric Lander, data from MR Stratton et al. Nature 458, 719-724 (2009) 1980198519901995200020052010Future Year Single molecule? Short-read sequencers Microwell pyrosequencing Second-generation capillary sequencer First-generation capillary Automated slab gel Manual slab gel Gel-based systems Capillary sequencing Massively parallel sequencing 1,000,000,000 100,000,000 10,000,000 1,000,000 100,000 10,000 200 100 10 Kilobases per day per machine Sequencing Output (currently 1-2 Gb per machine per day) 11 LBJ School, CHASP

12. IDENTIFY GENES, VARIATIONS, EXPRESSION Monogenic diseases – rare single gene disorders: Thalassaemia Sickle cell anemia Haemophilia Cystic Fibrosis Tay sachs disease Fragile X syndrome Huntington's disease… Genetic tests available for about 1800 diseases The accurate diagnosis of single-gene disorders and diseases has led, for example, to the development of screening programmes for cystic fibrosis and sickle cell anaemia in newborns. 12 LBJ School, CHASP

13. MULTIFACTORIAL DISEASES Atherosclerosis, hypertension, obesity, diabetes, asthma, migraine, epilepsy, depression, bipolar disorder, autism, schizophrenia, multiple sclerosis, psoriasis, cancers and pathogenic infections Complex diseases have a low heritability Several to many genes may contribute Environmental/lifestyle factors also contribute to risk 13 LBJ School, CHASP

14. Cholesterol Obesity Myocardial infarction QT interval Atrial Fibrilliation Type 2 Diabetes Prostate cancer Breast cancer Colon cancer Height Uric Acid KCNJ11 20032000 PPAR  2001 IBD5 NOD2 20052006 2002 CTLA4 2004 PTPN22 Age Related Macular Degeneration Crohns Disease Type 1 Diabetes Systemic Lupus Erythematosus Asthma Restless leg syndrome Gallstone disease Multiple sclerosis Rheumatoid arthritis Glaucoma Celiac Disease CD25 IRF5 PCSK9 CFH 2007 NOS1AP IFIH1 PCSK9 CFB/C2 LOC387715 8q24 IL23R TCF7L2 Confirmed genetic contributors to common human diseases (Dec 2007) FGFR2 TNRC9 MAP3K1 LSP1 8q24 CDKN2B/A 8q24 (n=6) ATG16L1 5p13 10q21 IRGM NKX2-3 IL12B 3p21 1q24 PTPN2 TCF2 CDKN2B/A IGF2BP2 CDKAL1 HHEX SLC30A8 TBL2 TRIB1 KCTD10 ANGLPT3 GRIN3A MEIS1 LBXCOR1 BTBD9 C3 8q24 ORMDL3 4q25 TCF2 GCKR FTO C12orf30 ERBB3 KIAA0350 CD226 16p13 PTPN2 SH2B3 ITGAM BLK HMGA2 GDF5-UQCC HMPG CRAC1 JAZF1 CDC123 ADAMTS9 THADA WSF1 LOXL1 GLUT9 L7R TRAF1/C5 STAT4 4q27 ABCG8 MLXIPL GALNT2 PSRC1 NCAN 14 LBJ School, CHASP Slide from Eric Lander

15. ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATG CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGG ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACT TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATG ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTC ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTT CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGC ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCC ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTC GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGAT ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGC CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG Single Nucleotide Polymorphisms (SNPs): 1 heterozygous site per 1300 Most SNPs are common variants in population 15 LBJ School, CHASP

16. Human Genotyping: Major Technology Advances SNPs per assay 19971 200110 2002 1,000 200450,000 2006 500,000 2007 1,000,000 1998: POC 500-plex Slide from Eric Lander

17. LBJ School, CHASP 17

18. POLICY CHALLENGES: CIRCA 2000 Tension between access to research results and commercial applications – open source & IPRs Tension between research usage and privacy/security of personal genetic data International collaboration in research and clinical diagnostics in absence of harmonisation of “regulatory” approaches Uncertain receiving environment (regulatory & clinical) for new products Need for meaningful public engagement 18 LBJ School, CHASP

19. ETHICAL, LEGAL & SOCIAL ISSUES – CIRCA 2010 Access and use of genetic information by insurers, employers, courts, researchers. Privacy and confidentiality Clinical issues validation, appropriate use, interpretation, education/training Personal Genomics Direct to Consumer marketing of Genetic Information Psychological impact and stigmatization of individuals and groups Reproductive issues IP/Commercialisation 19 LBJ School, CHASP

20. OECD EXPERT GROUPS CREATED TO: 1.Examine possible impacts of restrictive licensing practices for genetic inventions and policy options for avoiding these. 2.Develop internationally recognised and mutually compatible best practice policies for quality assurance of MGTs. 3.Develop guidance on privacy and security guidelines to ensure adequate security of biobanks and genetic databases. 4.Exploration of economic and social impacts of pharmacogenetics. 20 LBJ School, CHASP

21. OECD R ECOMMENDATIONS ON : 2006 -- Licensing practices for (patented) genetic inventions 2007 – Quality of clinical (molecular) genetic tests 2009 -- The privacy and security of biobanks and genetic databases 21 LBJ School, CHASP

22. OECD RECOMMENDATION ARE… Instruments of the Organisation Negotiated texts Adopted by consensus, at whole of government level Non-binding: a commitment on the part of member countries to make good faith efforts to implement Often serve as “pre-law” for articulation of national legal instruments An Acquis of the Organisation, such that new members must demonstrate they are willing and able to implement Instrument 22 LBJ School, CHASP

23. NEGOTIATION STAGES 1.Identification of issue (surveys, analytical reports, workshops) 2.Creation of government appointed “expert group” 3.Expert drafting of good practices 4.Agreement by countries to release draft “best practices” for public consultation 5.Expert redraft of “best practices” in light of comments 6.Substantive Committee agreement on draft Instrument 7.OECD Council Adoption of Recommendation 23 LBJ School, CHASP

24. THE PROBLEM WITH GENETIC INVENTIONS Proliferation of gene patents -- genes, SNPs, ESTs -- was issue of concern for a variety of interest groups Dependency problems, reluctance of researchers to enter fields where genes have already been patented or where multiple groups are competing to patent a same gene, restrictive licensing practices, royalty stacking, database access problems. How frequently do these issues arise? What are the costs? 24 LBJ School, CHASP

25. COUNTRIES WANTED TO RESOLVE: Do gene patents impede research, new product development, access to new products/services? Do patents on genes need to be circumscribed, or is the research and clinical community adapting to the new environment with new strategies? How can governments assure legitimate access to genetic information and distribute research results, funded by the public, so that they benefit the public. What are the policy tools available to governments to reach this objective? 25 LBJ School, CHASP

26. WHAT WAS AT STAKE? Harmonisation – or lack thereof – of global IP regime,(eg new exceptions to patentability) Revenues for public research organisations Biotech industry business model Negotiation positions in other international organisations: WTO WIPO WHO Health care costs, quality and equity of access 26 LBJ School, CHASP

27. SURVEY OF PATENTS & CLINICAL GENETIC TESTING LABORATORIES 65% offer genetic tests covered by patents recognized in the country Patent has affected: - Cost of Test70% - Number of Tests Performed28% - Quality of the Test20% 10% of labs have ceased offering genetic test or tests that are covered by patent 27 LBJ School, CHASP

28. 2006 GUIDELINES FOR THE LICENSING OF GENETIC INVENTIONS Set out principles and best practices for those in business, research and health systems who enter into license agreements for genetic inventions used for the purpose of human health care. Foster the objectives of stimulating genetic research and innovation while maintaining appropriate access to health products and services. [Change norms about the manner in which rights holders carry out licensing activities. While maintaining legitimacy of patents for genetic inventions…] 28 LBJ School, CHASP

29. 1. GENERAL LICENSING How to : ownership rights, collaborative research, confidentiality provisions… 1.1 License agreements should permit licensees to develop and further improve the licensed genetic inventions. 1.5License agreements should not provide the licensor with exclusive control over human genetic information, including collections of such information, derived from individuals through the use of the licensed genetic invention. 1.6Rights holders should be encouraged to agree to licensing terms and conditions that maximize the utilisation of their genetic inventions. 29 LBJ School, CHASP Myriad DeCode Funding bodies

30. 2. HEALTH CARE AND GENETIC INVENTIONS 2.CLicensing practices should not be used to restrict the choice of other products or services by patients and their healthcare providers. 2.DLicensing practices should encourage appropriate access to and use of genetic inventions to address unmet and urgent health needs in OECD member countries and non- member economies. 30 LBJ School, CHASP Myriad Neglected diseases?

31. 3. RESEARCH FREEDOM 3.BCommercial considerations in public research activities should not unduly hinder the academic freedom of researchers. 3.C Commercial considerations… should not unduly limit the ability to publish in a timely manner the results of research. 3 D Commercial considerations in public research activities should not unduly limit the educational training of students. 31 LBJ School, CHASP PRO policies and contracts w/private sector

32. 4. COMMERCIALISATION 4.1 Should several licenses be required, license agreements should include a mechanism to set a reasonable overall royalty burden… 4.2 License agreements should… maintain low barriers for access to genetic inventions… [and] … not include [] excessive up-front fees. 4.3 License agreements should avoid reach-through rights…. 4.4 Private and public sector participants should develop mechanisms to decrease transaction costs in acquiring rights to use technology. 32 LBJ School, CHASP Oncomouse Pools & Consortia Gene Chips

33. WHAT WAS MISSED? Definition of what sort of data or invention should be kept open? SNPs data GWAS Contentious… Conditions for patentability LBJ School, CHASP 33

34. CREATION AND GOVERNANCE OF HUMAN GENETIC RESEARCH DATABASES Research involving data and samples from human biobanks and genetic research databases analysed in conjunction with personal or health data is important for healthcare and drug discovery; That research must respect the participants and be conducted in a manner that upholds human dignity, fundamental freedoms and human rights; 34 LBJ School, CHASP

35. BIOBANK EXAMPLES UK Biobank – 60 million NHS patients CARTaGENE – 20,000 Quebecois GenomeEUtwin – 600,000 twin pairs deCode, Iceland – >270,000 Icelandic citizens 23andMe – maybe 6,000 paying customers Kaiser Permanente -- 100,000 Northern Californians to be included ina genetic database: Research Program on Genes, Environment, & Health 35 LBJ School, CHASP

36. BIOBANKS: WHAT COUNTRIES WANTED Guidance for the establishment, governance, management, operation, access, use and discontinuation of HBGRDs. governance structure and oversight mechanisms; privacy and confidentiality; terms of participation; access; funding mechanisms; benefit sharing, intellectual property and commercialisation; protection and security of human biological materials and data; the qualifications, education and training of staff; disposal of materials and data and the discontinuation of a HBGRD. 36 LBJ School, CHASP

37. BIOBANKS: WHAT IS AT STAKE? Public Trust and participation in large scale genomic studies – public or private Large scale research on genetic basis of health and disease Privacy and security of personal health information Public money – biobanks are subsidised and go bust 37 LBJ School, CHASP

38. 3. GOVERNANCE, MANAGEMENT, AND OVERSIGHT 3.AThe HBGRD should be governed by the principles of transparency and accountability. 3.BThe operators of the HBGRD should clearly formulate its governance structure and the responsibilities of its management and should make such information publicly available. 3.CThe governance structure should be designed to ensure that the rights and well-being of the participants prevail over the research interests of the operators and users of the HBGRD. 3.DThe… should have in place oversight mechanisms to ensure that… comply with legal requirements and ethical principles. 38 LBJ School, CHASP

39. 4. TERMS OF PARTICIPATION 4.AParticipant recruitment should be carried out in a non-coercive and equitable manner that respects individual freedom of choice. 4.BPrior, free and informed consent should be obtained from each participant. 4.CThe operators of the HBGRD should give careful consideration to any special issues related to the participation of vulnerable populations or groups, and their involvement should be subject to protective conditions... 4.D…should have a clearly articulated policy on whether participants may be re-contacted [and] the situations for which re-contact will be permitted... 39 LBJ School, CHASP Consent for new research DTC consumer

40. 7. ACCESS 7.AAccess to human biological materials and data should be based on objective and clearly articulated criteria, and should be consistent with the participants’ informed consent. 7.DResearchers should only have access to human biological materials or data that are coded or anonymised, such that the participant cannot be identified, and researchers should be required to not attempt to re- identify participants... 7.8The operators of the HBGRD should formulate policies and procedures setting out the manner in which an individual participant can request information and data about him/herself contained in the HBGRD, how those requests will be handled, and which information and data, if any, can be made available. 40 LBJ School, CHASP

41. 9. CUSTODIANSHIP, BENEFIT- SHARING AND INTELLECTUAL PROPERTY 9.BBenefits arising from research using the HBGRD’s resources should be shared as broadly as possible, including by the sharing of information, licensing, or transferring of technology or materials. 9.CThe… HBGRD should have a clearly articulated policy and explicitly indicate to participants whether they and/or the HBGRD retain any rights over the human biological materials and/or data and the nature of such rights. 9.DThe… HBGRD should have a clearly articulated policy… relating to the commercialisation of its own resources, research results derived from those resources, and/or commercial products, if any, that may arise from research using its resources. 41 LBJ School, CHASP

42. WHAT IT MISSED? Public willingness to participate in [commercial] biobanks in exchange for personal genetic data and “information” Blurring of research and commercial databanks Emerging norm of making personal genetic information “open” 42 LBJ School, CHASP

43. COMMON FEATURES OF TOPICS THAT ARE AMENDABLE TO INTERNATIONAL SOFTLAW Confluence of research, and industry and governmental concern A tangible and a specific problem to be solved Existence of set of feasible solutions Demand for inter-governmental action “Lowest common denominator” approach – no country can insist on highest standard Large country leadership Needed for public legitimacy Needed to pressure action domestically Low/no cost – (e.g. no new infrastructures) Implementation is local/national 43 LBJ School, CHASP

44. THANK YOU! Benedicte.Callan@austin.utexas.edu LBJ School, CHASP 44