Presentation is loading. Please wait.

Presentation is loading. Please wait.

Robert H Yolken, MD Director, Stanley Neurovirology Laboratory

Published byStuart Gervase Weaver Modified over 9 years ago

Similar presentations

Presentation on theme: "Robert H Yolken, MD Director, Stanley Neurovirology Laboratory"— Presentation transcript:

1 Schizophrenia and Other Human Psychiatric Diseases Challenges for 21st Century Researchers
Robert H Yolken, MD Director, Stanley Neurovirology Laboratory Ted and Vada Stanley Distinguished Professor of Pediatrics, Johns Hopkins School of Medicine, Baltimore Md. E Fuller Torrey, MD Medical Director, Stanley Medical Research Institute, Bethesda Md Faith Dickerson, PhD Director of Psychology, Sheppard Pratt Health System, Baltimore Md.

2 Schizophrenia Clinical and Epidemiological Features
Positive Symptoms Hallucinations, Delusions, Disordered Thinking Negative Symptoms Withdrawal, Amotivation, Restricted Expressiveness Impairment in Cognitive and Social Functioning Structural and Functional Brain Abnormalities Lifetime prevalence approximately 1% Peak onset of Symptoms in Young Adulthood Massive societal Consequences Worldwide Currently Available Medications Symptomatic improvement High rate of side effects Do not affect overall disease process

3 Genetics Of Schizophrenia
Increased Incidence in Biological First Degree Relatives General Population  1% First Degree Relatives 7-9% Monozygotic Twins  30% Most individuals with schizophrenia do not have a first degree relative with this disease. Genetic factors have a large relative risk but a small risk in the overall population (5%) Intensive search for genes using molecular methods Multiple (>30) chromosomal regions of linkage Genetic polymorphisms of minor effect (OR~2) No genes of major effect in different populations

4 Microbial Agents and Schizophrenia Epidemiological Findings
Specific Infectious Agent Perinatal Rubella (Brown et al, 2001; OR~3.5) Neonatal Enterovirus (Jones et al, 1998 OR~4) Maternal Herpesvirus (Buka 2001; OR~4) Possible Infectious Exposure Seasonality of Birth (Torrey at al, 1998; OR~2) Urban Birth (Mortenson et at, 1999, OR~2.5) Exposures in Pregnancy (Brown et al, 2000; Torrey et al, OR~3) Case Reports HIV Herpes Simplex Virus Borrelia bergdorferii

5 Human Infectious Diseases Known Genetic Associations
Agent Gene Function HIV CCR Co-Receptor EBV XLP T-Cell Activity Hepatitis B Man BP Viral binding Mycobacteria Il12; IFN R Phagocytosis Salmonella Il12; IFN R Phagocytosis H pylori HLA-DQ Immune Response S mansoni GMCSF Phagocytosis L donovani Cytokines Immune Function P falciparum HgS,G6PD Oxygenation

6 Psychiatric Disorders Association with Viral Encephalitis
Caroff et al, Psych Ann 31:193, 2001

7 Infections and Psychosis Bacteria and Parasites
Streptococcus pyogenes Borrelia burgdorferi Treponema pallidum Ehrlichiae Mycoplasma pneumoniae Bartonella henselae Salmonella typhii Parasites Toxoplasma gondii Plasmodium falciparum Babesiae Taenia solium Leishmania donovani

8 Antecedents of Schizophrenia 264 Cases/528 Controls
Fever in Pregnancy Pregnancy Complications Delivery Complications Urban Birth Developmental Delay Family Cat Family Dog 1 2 3 4 Scz Research 46:17-23, 2000 Odds Ratio (95% Conf)

9 Schizophrenia Working Hypotheses
Most cases of schizophrenia are the result of infections and other environmental insults occurring in genetically susceptible individuals before the onset of clinically apparent symptoms. Distinct gene-environmental interactions may be operant in different populations. The role of specific infectious agents can be defined by clinical trials of anti-microbial chemotherapy.

10 Identification of Infections in Schizophrenia Methods-Old and New
Analytic Methods Differential Display PCR Library screening Microarrays Two-dimensional electrophoresis Enzyme immunoassays Samples for Analysis Brains collected by the Stanley Neuropathology Consortium Cerebrospinal fluid and blood samples from individuals with recent onset schizophrenia Blood samples from mothers of infants who developed schizophrenia in adult life

11 Differential Display PCR Brain from Individual with Schizophrenia (S) and Unaffected Control(U)

12 Human Endogenous Retrovirus HERV-W
HIV Human Endogenous Retrovirus HERV-W

13 Endogenous Retroviruses Borderland Between Viruses and Genes II
Dynamic Effects on Gene Function Promoter control of adjacent genes- PLA2; Placental Genes Functionality of viral proteins-Syncytin; ASCT1 Glutamate transporter Interaction with infectious agents- Herpesviruses; Toxoplasma Interaction with soluble mediators-Hormones; Cytokines Role in Human Disease Diabetes- Superantigen activation Multiple Sclerosis- Glial cell function Autoimmune Arthritis- T cell activity

14 Endogenous Retroviruses Activation and Transcription
Microbe Hormone Mediator DNA 5’LTR Viral Proteins 3’LTR

15 Human Retroviruses Activation by Herpesviruses
Reverse Transcriptase Activity Herpesvirus Retrovirus

16 Endogenous Retroviral PCR CSFs:Schizophrenia and Controls
Scz DNA Ctr Herv-W HERVw GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG C C A A TG- A A TG- A C C--G G- A A T C--G TG- A A A T CA---TA C--G TG-

17 Reactivity to Retroviruses Schizophrenia and Controls

18 Collaborative Perinatal Study Study Design
65,000 healthy mothers enrolled from from 11 geographically diverse sites. Mothers followed closely during pregnancy. Neurocognitive and developmental testing during first 7 years of life. Primary outcomes cerebral palsy and mental retardation. Serum samples obtained from mothers during pregnancy and infants at birth (cord). Offspring identified with psychiatric diseases in 1990’s and matched to maternal and cord blood serum specimens.

19 Schizophrenia in Adult Life Inflammation During Fetal Development

20 Schizophrenia in Adult Life Infection During Fetal Development
6.00 4.80 3.60 Odds Ratio 2.40 1.20 0.00 CMV IgG CMV IgM Rub IgG Rub IgM Toxo IgG Toxo IgM HSV1 IgG HSV2 IgG Herv W

21 National Children’s Study
Mandated by congress in 1999 Scheduled to start in 2004 Target enrollment of 100,000 births Follow-up of offspring for 30 years Specimen Collection and Storage Unanswered questions Target diseases Number of sites Consent requirements System of medical care

22 Cognitive Score (RBANS Total) Infection and Cognitive Functioning
HSV-1 Toxo CMV HSV-2 EBV HHV-6 60 65 70 75 80 Cognitive Score (RBANS Total) Infection and Cognitive Functioning Individuals with Schizophrenia (N=229) Antibody Positive Antibody Negative ** * **p<.00001 Infectious Agent (IgG Antibodies) *p<.009

23 Cognitive Functioning in Bipolar Disorder Effect of HSV-1 Infection

24 Cognitive Functioning Schizophrenia and Bipolar Disorder
HSV-1 Infected HSV-1 Uninfected 100 90 Score 80 70 60 Memory Total Cognitive Memory Total Cognitive Bipolar Disorder Schizophrenia

25 Acylovir-Mechanism of Action

26 Valacyclovir Clinical Trial Individuals with Schizophrenia
Enrollment of 66 patients with stable schizophrenia on standard medication all given Valacyclovir 2 gm/day for 16 weeks Evaluation by the positive and negative symptom score (PANSS) Change in score correlated with viral antibody status at start of study HSV1/2 CMV Other herpesviruses

27 Response to Valacyclovir HSV-1 Antibody Status
HSV-1 Seropositive HSV-1 Seronegative Positive Symptoms Total Symptoms

28 Response to Valacyclovir by CMV Status
2 4 8 12 16 -10 10 20 30 Percentage Improvement Positive Scale Negative Scale P<.006 General Scale Total Score 20 20 P<.02 P<.0005 10 10 Percentage Improvement -10 -10 4 8 12 16 2 4 8 12 16 CMV Seropositive CMV Seronegative

29 Prevalence of Cytomegalovirus Populations with Schizophrenia
Cologne-Untreated Cologne-Recently Treated Cologne-Control Heidelberg-Recently Treated Heidelberg-Control Baltimore-Chronic 10 20 30 40 50 60 70 80 90 Prevalence (%)

30 New Therapies for Schizophrenia Ongoing/Proposed Clinical Trials
Treatment Trials Valacyclovir Other medications for Cytomegalovirus Azithromycin trial for Toxoplasma gondii Antimicrobial aspects of Psychiatric Medications Epidemiological Studies Additional Perinatal Cohorts Cohorts of Healthy Young Adults Cohorts of High-Risk Adolescents Intervention strategies for disease prevention

31 Infections and Schizophrenia Conclusions
Recent onset schizophrenia is associated with: Increased transcription of HERV-W Increased levels of antibodies to CMV Past infection with HSV-1 and Toxoplasma gondii are associated with cognitive impairment in individuals with stable schizophrenia. Maternal exposure to infectious agents is associated with an increased rate of schizophrenia in the adult life of the offspring. The administration of Valacyclovir can reduce symptoms in some individuals with stable schizophrenia.

32 Microbial Agents and Schizophrenia Acknowledgements
Harvard University Steve Buka Ming Tsuang University of Heidelberg Silke Bachmann Johannes Schroeder Karolinska Institute Håkan Karlsson University of Cologne F Markus Leweke Johns Hopkins University Loraine Brando Vern Caruthers Inna Ruslanova Bogdana Krivogorsky Stanley Program Michael Knable John Bartko Sheppard Pratt Hospital Faith Dickerson John Boronow Catherine Stallings

Download ppt "Robert H Yolken, MD Director, Stanley Neurovirology Laboratory"

Similar presentations

Generation R Study Claudia Kruithof, MSc datamanager Generation R EUCCONET workshop june 2011 – Record Linkage.

Generation R Study Claudia Kruithof, MSc datamanager Generation R EUCCONET workshop june 2011 – Record Linkage.
Option F: Microbes and Biotechnology F.3 Microbes and Biotechnology.

Option F: Microbes and Biotechnology F.3 Microbes and Biotechnology.
Progress in Understanding the Neurobiology of Schizophrenia Daphne Holt, MD, PhD Director of Research, Schizophrenia Clinical and Research Program Department.

Progress in Understanding the Neurobiology of Schizophrenia Daphne Holt, MD, PhD Director of Research, Schizophrenia Clinical and Research Program Department.
Joy Welham Sukanta Saha John McGrath A Review of Risk Factors for Schizophrenia.

Joy Welham Sukanta Saha John McGrath A Review of Risk Factors for Schizophrenia.
Understanding Cognitive Disability in Schizophrenia Cameron S. Carter MD University of California at Davis.

Understanding Cognitive Disability in Schizophrenia Cameron S. Carter MD University of California at Davis.
Protozoan parasite of human importance Disease : Toxoplasmosis Agent : Toxoplasma gondii Diverse routes of transmission Tissue-inhabiting Apicomplexan.

Protozoan parasite of human importance Disease : Toxoplasmosis Agent : Toxoplasma gondii Diverse routes of transmission Tissue-inhabiting Apicomplexan.
Congenital Infections

Congenital Infections
Routine HIV Screening in Health Care Settings David Spach, MD Clinical Director Northwest AIDS Education and Training Center Professor of Medicine, Division.

Routine HIV Screening in Health Care Settings David Spach, MD Clinical Director Northwest AIDS Education and Training Center Professor of Medicine, Division.
Mind and brain are two sides of one coin; Disorders of the mind* are disorders of the brain. * schizophrenia, depression, anxiety, psychopathy, etc.

Mind and brain are two sides of one coin; Disorders of the mind* are disorders of the brain. * schizophrenia, depression, anxiety, psychopathy, etc.
Kate Hooks.  A Common Consultation  AIMS:  To distinguish rashes which may have complications from those which do not.  To develop a management strategy.

Kate Hooks.  A Common Consultation  AIMS:  To distinguish rashes which may have complications from those which do not.  To develop a management strategy.
Chapter 5 Environmental and Psychosocial Causes © Taylor & Francis 2015.

Chapter 5 Environmental and Psychosocial Causes © Taylor & Francis 2015.
DHMC - NCCC Familial Cancer Program Bradley A. Arrick, MD, PhD, Medical Oncologist, Co-Director of Familial Cancer Program John Moeschler, MD, Clinical.

DHMC - NCCC Familial Cancer Program Bradley A. Arrick, MD, PhD, Medical Oncologist, Co-Director of Familial Cancer Program John Moeschler, MD, Clinical.
1 Institute of Epidemiology and Infectious Diseases Research Activities The L.V. Gromashevsky Institute of Epidemiology and Infectious Diseases Svetlana.

1 Institute of Epidemiology and Infectious Diseases Research Activities The L.V. Gromashevsky Institute of Epidemiology and Infectious Diseases Svetlana.
Perinatal Infectious Diseases Dr. Hazem Al-Mandeel.

Perinatal Infectious Diseases Dr. Hazem Al-Mandeel.
STORCH Congenital infections that can cause birth defects.

STORCH Congenital infections that can cause birth defects.
Pregnancy Outcome Prediction Study University Department of Obstetrics and Gynaecology; PI – Professor Gordon CS Smith BACKGROUND The current pattern of.

Pregnancy Outcome Prediction Study University Department of Obstetrics and Gynaecology; PI – Professor Gordon CS Smith BACKGROUND The current pattern of.
Rituximab (RITUXAN) & Multiple Sclerosis

Rituximab (RITUXAN) & Multiple Sclerosis
Tom Rand MD PhD St. Luke’s Children’s Infections and Immune Deficiency Clinic February 20, 2015.

Tom Rand MD PhD St. Luke’s Children’s Infections and Immune Deficiency Clinic February 20, 2015.
Introduction to Molecular Epidemiology Jan Dorman, PhD University of Pittsburgh School of Nursing

Introduction to Molecular Epidemiology Jan Dorman, PhD University of Pittsburgh School of Nursing
The Early Childhood Roots of Adult Health: Closing the Gap Between What We Know and What We Do JACK P. SHONKOFF, M.D. JULIUS B. RICHMOND FAMRI PROFESSOR.

The Early Childhood Roots of Adult Health: Closing the Gap Between What We Know and What We Do JACK P. SHONKOFF, M.D. JULIUS B. RICHMOND FAMRI PROFESSOR.

Similar presentations

Ads by Google