1. MENDELIAN AND modern genetics

2. Vocabulary Alleles: Dominant: Gene: Genetics: Genotype: Heterozygous:
Homozygous:
Incomplete Dominance:
Phenotype:
Recessive:
Vocabulary

3. What is genetics? Who is Gregor Mendel? The study of heredity.
Transferring information from 1 generation to the next.
Who is Gregor Mendel?
1. A monk, gardener, scientist – 19th century
2. Conducted experiments of heredity using pea plants
3. Developed the principles of dominance, segregation, independent assortment

4. More about Gregor Mendel…..
4. He really loved math and statistics (you may ask yourself why??!!)
5. Mendel began to notice a pattern in his pea plants.
In each generation some of the plants looked like the others, but some were different! (hmmm…)
He came up with the laws of genetics.

5. Why use pea plants? What did he do first? Easy to grow Mature quickly
Lots of offspring
Only 2 alleles/gene
What did he do first?
Carried out a controlled, scientific study.

7. POSSIBLE PEA PLANT ALLELES
Seed Shape
Seed Color
Seed Coat
Color
Pod
Shape
Pod Color
Flower Position
Plant Height
Axial
Round
Yellow
Gray
Smooth
Green
Tall
Wrinkled
Green
White
Constricted
Yellow
Terminal
Short
Round
Yellow
Gray
Green
Smooth
Axial
Tall

8. There are alternative forms of the same gene; alleles
Each organism has 2 alleles for each trait one from each parent; heterozygous and homozygous
Dominant alleles can mask the expression of the “lesser” allele; dominant and recessive
Alleles segregate during gametogenesis. Each gamete has only 1 allele; law of segregation
Mendel’s Hypothesis

9. How many copies of each gene?
gene from mom & 1 gene from dad
Then what is an allele?
The trait (characteristic) found on a gene.
Where do they come from?
1 gene from mom & 1 gene from dad

10. 2 alleles for color in pea plants:
Green = G
yellow = g
2 alleles for height in pea plants:
Tall = T
short = t

11. What does dominant mean?
One allele is more powerful than the other.
TT or Tt
What does recessive mean?
One allele is overpowered by the other. tt

12. What does homozygous mean?
Both alleles from the parents are the same.
Either: TT or tt
What does heterozygous mean?
The alleles from the parents are different. Tt

13. What is genotype? What is phenotype?
The genetic makeup of an individual.
The “letters” (ex: TT, Tt, tt)
What is phenotype?
The physical makeup of an individual.
The description (ex: Tall or Short)

14. Mendel’s law of dominance:
Name some possible genotypes and phenotypes for the height of a pea plant:
Genotype Phenotype
Tall TT Tt
Tall
short tt
Mendel’s law of dominance:
The dominant trait overpowers the recessive.

15. Law of Segregation and Recombination:
Mendel explained that “factors” which occur in pairs
are separated from each other during gamete
formation and recombined at fertilization.
Law of Independent Assortment:
Mendel concluded that different traits are inherited
independently of one another
(genes for different traits are separated &
distributed to gametes independently of one
another when they are on different chromosomes).

16. B b B b Phenotypes: % Brown % white Genotypes: % BB % Bb % bb
What will be the percentage of Phenotypes?
Phenotypes:
% Brown
% white
What will be the percentage of Genotypes? B b
Genotypes:
% BB
% Bb
% bb B b

17. B b B B B b b b B b Phenotypes: 75% Brown 25% white Genotypes: 25% BB
ANSWER:
Phenotypes:
75% Brown
25% white B b
B B
B b
b b B
Genotypes:
25% BB
50% Bb
25% bb b

18. What is a test cross?
Used to find out the genotype of an unknown individual.
Ex: a black dog—is it pure or hybrid?
BB or Bb? (B=Black b=brown)

19. What is incomplete dominance?
AKA Intermediate Inheritance
The result is a blending of traits.
What is codominance?
Both alleles are equally dominant
The result is a streaking affect.

20. Test Cross:
Consider a phenotypically tall organism. What is it’s genotype? Is it TT or Tt? To answer this question, you would do a test cross:
definition:
*By observing the phenotypes of the offspring, we can trace back to the genotype of the parent:
If the genotype If the genotype
of the parent was of the parent was
homozygous (TT), heterozygous (Tt),
all the offspring are tall: % of the offspring
are tall and 50% are
short:
when an organism showing the dominant trait is crossed with a pure recessive to determine if that dominant organism is homozygous or heterozygous
T t Tt tt
T T t Tt t

21. What are multiple alleles?
When there are more than 2 alleles for a gene in an entire population.
Ex: hair color, eye color, blood type
Alleles A B O

22. ~when there are more than 2 (“multiple”) alleles for a trait
~example: Human blood groups
have 3 alleles: IA where I is dominant
IB and i is recessive i
~the possible combinations of these 3 blood alleles are as follows:
Blood type genotype
Phenotype A B AB O
IAIA or IAi
IBIB or IBi
IAIB ii

23. Polygenic Inheritance Poly = “Many” Genic = “Genes”
More than one gene influences a single trait
Ex) Height & skin color

24. Does the environment influence the expression of a phenotype?
Available Nutrition
Affects growth & health
Exercise / Activity
Temperature
Affects many characteristics
Skin color, health, etc

25. Chromosome Theory of Inheritance
Mendel’s Principles
Meiosis explains Mendel’s principles
Chromosome Theory of Inheritance
Genes are located on chromosomes
The behavior of chromosomes during meiosis & fertilization explains inheritance patterns

26. What does this tell you about inheritance of traits A & E?
What is gene linkage?
When 2 genes are found on the same chromosome. (Genes A-E are linked)
What does this tell you about inheritance of traits A & E?

27. Crossing over To recombine the alleles when the genes are far apart
The exchange of genetic material between homologous chromosomes
Crossing over

28. How is gender determined?
It is a 50/50 chance to get a boy or a girl
Girls = XX Boys = XY
XX x XY
Mom x Dad

29. Punnett Squares Gender Determination

30. 46 female male sperm fertilization X X Y Sex Determination:
~there are 2 types of chromosomes: sex chromosomes (1 pair)
autosomes (all other pairs)
~in each diploid human cell this looks like:
sex chromosomes 1 pair
autosomes 22 pairs
23 homologous pairs or _____chromosomes
~The genotype XX represents a _______________
~The genotype XY represents a _______________
~The sex of an individual is determined by the _______________ at the time of________________________.
~The human egg contains only ______ chromosomes while the human sperm can contain either ______ or _______ chromosomes. 46
female
male
sperm
fertilization X X Y
X X
Every time a man and woman have a child there is a ________ chance it will be a boy or girl. X Y XX XY
50 / 50

31. Sex Linkage:
~sex-linked traits are caused by genes found on the X chromosome
~sex-linked traits are recessive
~since they are recessive, fewer females are afflicted with these traits because they have another X chromosome which is dominantly normal. Males have only one X chromosome so when they have a sex-linked gene, they’ll display the trait.
~the genotype of a sex-linked trait is represented as_________
~females with one gene for the trait ( X X ) are called_____________
~examples of sex-linked traits: hemophilia, color- blindness
X or X (can also be represented as Xh, where h is the trait)
carriers

32. Pedigree charts: used to show he presence or absence of
Pedigree charts: used to show he presence or absence of a certain trait in families through several generations.
**they’re kind of like a “genetic family tree” Bb Bb Bb Bb bb bb bb

33. What is a hybrid? Offspring of parents that have different forms of a trait- ex). Tall and short.
Monohybrid Cross

34. Dihybrid Cross- cross with two traits

35. Modern Genetics

36. Name some foods that you eat.
(not in notes)
How is Genetics used in everyday life?
Name some foods that you eat.
How many of them do you think are genetically altered?

37. how to use this technology!!!!
Not in notes
Genetically Modified Foods
What are the Benefits?
What are the Risks?
Believe It or Not,
YOU are the generation
that will decide
how to use this technology!!!!

38. Is the complete set of genetic material in an organism- the order of the bases in the DNA
Can fit into the nucleus of a single cell because of the “packing system”
Genome

39. The Human Genome Project
Mapping the sequence of nucleotides…
ACCGTTTAACCGTATAGGACCACT…
for the entire amount of DNA in our cells
This info is then entered into a computer database
Researchers then compare the data to find genes, evolutionary links, and more

40. Recombinant DNA
Combines genes from different sources into a single DNA molecule
Why is this useful?
Organisms can be modified to produce products that benefit everyone
Examples:
Bacteria that could clean up oil spills or toxic waste sites
Vaccine production
Insulin production – Pure human form
Gene cloning
5. Genetically modified plants and animals

41. Biotechnology
The use of organisms to perform practical tasks for humans- to analyze and manipulate the genomes of organisms

42. Plasmids
A small circular DNA molecule separate from the much larger bacterial chromosome.

43. Plasmids – BIG DEAL
What can they be used for?

44. Restriction Enzymes
These are tools used to “cut” DNA in specific locations
AAAATTCCGAGACGAATTCAATACGAATTCGGGTTAAACCCCCGAATTCGGGCCTCA
How many times do you see GAATTC?
Draw a line between the G&A (in these sections)
So how many sections of DNA do you have now?

45. The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things.
**Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms.
Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

46. 1. **Transgenic animals are often used in research.
What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
2. **Transgenic plants and animals may have increased value as food sources.
What might happen to native species if transgenic animals or plants were released into the wild?

47. Nucleic Acid Probe Let’s say we want to find the sequence TAGGCT
A complimentary strand of DNA that has been radioactively labeled
Let’s say we want to find the sequence TAGGCT

48. Plants Animals Animal Cloning What is it How is it done When?
Use of plasmids from the soil to introduce new genes
To improve the characteristics of the plants
To delay ripening
Improved nutritional content
Resistance to spoilage or disease
Extract an egg cell
Sperm fertilizes the egg
Desired gene is injected into the fertilized egg
Same as plants- better quality “wool”
Or to mature in a shorter time
To make vaccines
Growth hormones
The nucleus from a single cell replaces the nucleus of an unfertilized egg from another animal- the egg develops into an animal that has the same genome as the nuclear donor
Cloning can offer the potential to mass produce an animal
Entire genomes can be cloned
“Dolly”

49. Polymerase Chain Reaction (PCR)
A method for amplifying a DNA base sequence.
How?
The newly synthesized DNA strands can serve as templates for making more DNA—amplifying the desired sequence.
When?
Can detect viral genes infected with the virus that causes AIDS

50. PCR

51. **Genetic Markers- particular stretches of DNA that are variable among individuals
Ex.) DNA fragments that include certain disease alleles have distinct genetic markers
**DNA fingerprinting- a particular banding pattern produced by your restriction fragments
- Unless you have an identical twin, it is unlikely to have the exact same fingerprint

52. Gel Electrophoresis
A method of separating large molecules (such as DNA fragments or proteins).
How?
An electric current is passed through a medium containing the mixture
Each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size.
Separation is based on these differences.

53. Gel Electrophoresis DNA plus restriction enzyme Power source
Longer fragments
Mixture of DNA fragments
Shorter fragments
Gel

57. Stem cells
-Cells with the potential to “turn into” an undifferentiated cells
-Have the potential into various types of cells

58. DNA Sequencing
Any lab technique used to find out the sequence of nucleotide bases in a DNA molecule or fragment.

59. DNA Sequencing Power source Gel Single strand of DNA Fluorescent dye
Strand broken after A
Strand broken after C
Strand broken after G
Strand broken after T
Power source
Gel
DNA Sequencing
Go to Section:

60. Gene Therapy
The process of introducing new genes into the DNA of a person's cells to correct a genetic disease or flaw

61. Making Recombinant DNA
Section 13-3
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
DNA recombination
Human Cell
Sticky ends
DNA insertion
Bacterial Cell
Plasmid
Bacterial cell containing gene for human growth hormone
Go to Section:
Bacterial chromosome

62. Cloning A body cell is taken from a donor animal.
Flowchart
Cloning
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an embryo.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.

63. Cloning of the First Mammal
A donor cell is taken from a sheep’s udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell
Egg Cell
Cloned Lamb
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
Embryo
The fused cell begins dividing normally.
The embryo develops normally into a lamb—Dolly
The embryo is placed in the uterus of a foster mother.
Foster Mother
Go to Section: