1. FBI’s CODIS DNA Database Combined DNA Index System Launched October 1998. Links to all 50 states. Used for linking serial crimes and unsolved cases to repeat offenders. Current backlog of >600,000 samples. Requires >4 RFLP markers and/or 13 core STR markers.

2. CSF1PO D5S818 D21S11 TH01 TPOX D13S317 D7S820 D16S539D18S51 D8S1179 D3S1358 FGA VWA 13 CODIS Core STR Loci AMEL Sex-typing Position of Forensic STR Markers on Autosomes

3. Information on 13 CODIS STRs D18S51 18q21.3 AGAA L18333137-2743 Locus Name Chromosomal Location Repeat Motif ISFH format GenBank Accession Allele in GenBank Allele Range Number of Alleles Seen CSF1PO 5q33.3-34 TAGAX14720 126-1615 FGA 4q28 CTTT M649822115-51.269 TH01 11p15.5 TCAT D0026993-1420 TPOX 2p23-pter GAAT M68651116-1310 VWA 12p12-pter [TCTG][TCTA] M258581810-2428 D3S1358 3p [TCTG][TCTA] NT_005997189-2020 D5S818 5q21-31 AGAT G08446117-1610 D7S820 7q11.21-22 GATA G08616126-1522 D8S1179 8 [TCTA][TCTG]G08710 128-1913 D13S317 13q22-31 TATC G09017135-1514 D16S539 16q24-qter GATA G07925115-1510 D21S1121q21 Complex [TCTA][TCTG] AP0004332924-3870 * * Butler, Forensic DNA Typing, Appendix 1

4. Short Tandem Repeat (STR) Markers TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA TAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACATG CTTACAGATGCACAC = 12 GATA repeats (“12” is all that is reported) Target region (short tandem repeat) 7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats The number of consecutive repeat units can vary between people

5. Short Tandem Repeats (STRs) The repeat region is variable between samples while the flanking regions where PCR primers bind are constant AATG 7 repeats 8 repeats AATG Homozygote = both alleles are the same length. Heterozygote = alleles differ and can be resolved from one another. Primer positions define PCR product size Fluorescent dye label

6. Commercial STR Kits Kit Contents: Allelic Ladders for Genotyping PCR Component Mix Primer Mix Positive Control DNA Sample Currently 2 Suppliers: Applied Biosystems and Promega Corporation Cost to User: $15-30 per DNA sample tested.

7. Commercially Available STR Kits *Caucasian population (rounded to 2 significant figures) NameSource Release Date STR Loci Included *Power of Discrimination TH01, TPOX, CSF1PO monoplexes Promega Feb 1993 TH01, TPOX, CSF1PO 1:410 AmpFlSTR  BlueApplied Biosystems Oct 1996 D3S1358, VWA, FGA 1:5000 AmpFlSTR  Green IApplied Biosystems Jan 1997 Amelogenin, TH01, TPOX, CSF1PO 1:410 CTTvPromegaJan 1997 CSF1PO, TPOX, TH01, VWA (vWF) 1:6600 FFFLPromegaJan 1997 F13A1, FES/FPS, F13B, LPL 1:1500 GammaSTRPromegaJan 1997 D16S539, D13S317, D7S820, D5S818 1:1.8x10 4 PowerPlex  (version 1.1 and 1.2 later) PromegaJan 1997 CSF1PO, TPOX, TH01, VWA, D16S539, D13S317, D7S820, D5S818 1:1.2x10 8 AmpFlSTR  Profiler  Applied Biosystems May 1997 D3S1358, VWA, FGA, Amelogenin, TH01, TPOX, CSF1PO, D5S818, D13S317, D7S820 1:3.6x10 9 AmpFlSTR  Profiler Plus  Applied Biosystems Dec 1997 D3S1358, VWA, FGA, Amelogenin, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820 1:9.6x10 10 AmpFlSTR  COfiler  Applied Biosystems May 1998 D3S1358, D16S539, Amelogenin, TH01, TPOX, CSF1PO, D7S820 1:8.4x10 5 AmpFlSTR  SGM Plus  Applied Biosystems Feb 1999 D3S1358, VWA, D16S539, D2S1338, Amelogenin, D8S1179, D21S11, D18S51, D19S433, TH01, FGA 1:3.3x10 12 PowerPlex  2.1 PromegaJun 1999 D3S1358, TH01, D21S11, D18S51, VWA, D8S1179, TPOX, FGA, Penta E 1:8.5x10 10 PowerPlex  16 PromegaMay 2000 CSF1PO, FGA, TPOX, TH01, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, Penta D, Penta E, amelogenin 1:1.8x10 17 AmpFlSTR  Identifiler  Applied Biosystems May 2001 CSF1PO, FGA, TPOX, TH01, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, D19S433, D2S1338, amelogenin 1:2.1x10 17

8. D8S1179 D21S11 D7S820 CSF1PO D3S1358 TH01 D13S317 D16S539 D2S1338 D19S433 D18S51 TPOX VWA AMEL D5S818 FGA GS500 LIZ size standard 6FAM (blue) VIC (green) NED (yellow) PET (red) LIZ (orange) AmpFlSTR ® Identifiler™

9. Applied Biosystems- Identifiler Allelic Ladders D3S1358D16S539 VWA AMEL D8S1179 D21S11 D18S51 D19S433 D5S818 FGA D2S1338 TPOX TH01D13S317 CSF1POD7S820 STR genotyping is performed by comparison of sample data to allelic ladders.

10. Promega Corporation- PowerPlex 16

11. PowerPlex ® 16 Ladders D3S1358 D16S539 VWA D8S1179 D21S11 D18S51 FGA Penta D TPOX D13S317 CSF1PO D7S820 AMEL Penta E TH01 D5S818

13. Why STRs are Preferred Genetic Markers Rapid processing. Abundant throughout the genome. Highly variable within populations. Small size range allows multiplex development. Discrete alleles allow digital record of data. Allelic ladders simplify interpretation. PCR based which allows use of small amounts of DNA. Small product size compatible with degraded DNA.

14. Microsatellite Mutations Polymerase slippage Unequal crossing-over during meiosis

15. Paternity Testing with Codis STRs

18. Separating the Men from the Sample

19. Why the Y Chromosome? Applications –98% of violent crime by men. –Genealogical purposes. –Evolutionary studies. Advantages to Y Identity Testing –Male component isolated without differential extraction. –Paternal lineages.

20. Haplogroups produced by Y SNP genotyping Underhill et al. (2000) Nature Genetics 26: 358-361 M42 M9 M96 M45 M89

21. Francesc Calafell et al. Genome Res. 2002; 12: 219-221 Haplogroups and geographic origins of all individuals in the Y Chromosome Consortium collection (2002)

22. Y-Chromosomal STRs 59,000,000 base pairs (only chromosome 22 is smaller). 161 genes. 95% is NRY (nonrecombining Y). 5% of it at the tips (telomeric) recombines. 44 Y-STR loci have been identified. SWGDAM (Scientific Working Group on DNA Analysis) endorses the use of 11 loci.

23. Nucleic Acids Res. 28(2), e8 (2000) Map of Y Chromosome STR Markers p q

24. Selection of U.S. Core Loci: DYS19, DYS385 a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS438, DYS439 Selection of U.S. Core Loci: DYS19, DYS385 a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS438, DYS439 Selection of Core Y-STR Loci

25. Y Chromosome STR Markers Most Commonly Used Markers J.M. Butler, Forensic DNA Typing, Table 8.1

26. DYS391DYS389IDYS439DYS389II DYS438 DYS437 DYS19DYS392 DYS393 DYS390DYS385 a/b Single amplification; ladders contain 103 alleles Promega PowerPlex ® Y Allelic Ladders U.S. Core Loci + DYS437

27. Yfiler Allelic Ladders U.S. Core Loci + DYS437, DYS448, DYS456, DYS458, DYS635, GATA H4

28. Reliagene- Y-Plex 6, Y-Plex 12

29. Genotyper Results with Reliagene Y Plex 6 Kit on 5 male candidate samples for SRM 2395

30. Megaplex- 21 Y-STR Loci. Hanson and Ballantyne 2004.

31. Thomas Jefferson II Field JeffersonPeter Jefferson President Thomas Jefferson Eston Hemings Thomas Woodson Different Y Haplotype Same Y Haplotype Jefferson Y Haplotype Jefferson Y Haplotype ? Figure 9.10, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press Historical Investigation of Jefferson-Hemings DNA Genetic Genealogy Companies SOURCE: Foster et al. (1998) Nature 396:27-28

32. Modern Use of Y-STR Testing Captured December 13, 2003 Is this man really Sadaam Hussein? Uday and Qusay Hussein Killed July 22, 2003 Matching Y-STR Haplotype Used to Confirm Identity (along with allele sharing from autosomal STRs) Butler, J.M. (2005) Forensic DNA Typing, 2 nd Edition, Box 23.1, p. 534