Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genome & Exome Sequencing Read Mapping Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520.

Similar presentations


Presentation on theme: "Genome & Exome Sequencing Read Mapping Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520."— Presentation transcript:

1 Genome & Exome Sequencing Read Mapping Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

2 Whole Genome Sequencing Usually need 30-50X coverage (~ 3 lanes of 100bp PE HiSeq2000 sequencing) 2

3 Exome Sequencing 2011 3

4 Exome Sequencing Solution Hybrid Selection: Probes in solution can capture all exons (exome) for high throughput sequencing 1-2% of whole genome seq Easily multiplex 20 samples in one lane 4

5 Comparative Sequencing Somatic mutation detection between normal / cancer pairs WGS or WES More mutation yield and better causal gene identification than Mendelian disorders 5 Meyerson et al, Nat Rev Genet 2010

6 Hallmark of Mendelian Disease Gene Discovery 6 Gilissen, Genome Biol 2011

7 Hallmark of Mendelian Disease Gene Discovery 7 Gilissen, Genome Biol 2011

8 Mutation Targets vs Disorder Frequency Rarer disorders are focused on fewer mutated genes 8 Gilissen, Genome Biol 2011

9 Whole Genome or Exome Seq? Enabling technologies: NGS machines, open-source algorithms, capture reagents, lowering cost, big sample collections Exomes more cost effective: Sequence patient DNA and filter common SNPs; compare parents child trios; compare paired normal cancer Challenges: –Still can’t interpret many Mendelian disorders –Rare variants need large samples sizes –Exome might miss region (e.g. novel non-coding genes) –Unsuccessful at using exome-seq to interpret clinical data 9 Shendure, Genome Biol 2011

10 Read Mapping Mapping hundreds of millions of reads back to the reference genome is CPU and RAM intensive, and slow Read quality decreases with length (small single nucleotide mismatches or indels) Very few mapper deals with indel, and often allow ~2 mismatches within first 30bp (4 ^ 28 could still uniquely identify most 30bp sequences in a 3GB genome) Mapping output: SAM (BAM) or BED 10

11 Spaced seed alignment Tags and tag-sized pieces of reference are cut into small “ seeds. ” Pairs of spaced seeds are stored in an index. Look up spaced seeds for each tag. For each “ hit, ” confirm the remaining positions. Report results to the user.

12 Burrows-Wheeler Store entire reference genome. Align tag base by base from the end. When tag is traversed, all active locations are reported. If no match is found, then back up and try a substitution. Trapnell & Salzberg, Nat Biotech 2009

13 Burrows-Wheeler Transform Reversible permutation used originally in compression Once BWT(T) is built, all else shown here is discarded –Matrix will be shown for illustration only Burrows Wheeler Matrix Last column BWT(T)T Burrows M, Wheeler DJ: A block sorting lossless data compression algorithm. Digital Equipment Corporation, Palo Alto, CA 1994, Technical Report 124; 1994 Slides from Ben Langmead

14 Burrows-Wheeler Transform Property that makes BWT(T) reversible is “LF Mapping” –i th occurrence of a character in Last column is same text occurrence as the i th occurrence in First column T BWT(T) Burrows Wheeler Matrix Rank: 2 Slides from Ben Langmead

15 Burrows-Wheeler Transform To recreate T from BWT(T), repeatedly apply rule: T = BWT[ LF(i) ] + T; i = LF(i) –Where LF(i) maps row i to row whose first character corresponds to i’s last per LF Mapping Final T Slides from Ben Langmead

16 Exact Matching with FM Index To match Q in T using BWT(T), repeatedly apply rule: top = LF(top, qc); bot = LF(bot, qc) –Where qc is the next character in Q (right-to-left) and LF(i, qc) maps row i to the row whose first character corresponds to i’s last character as if it were qc Slides from Ben Langmead

17 Exact Matching with FM Index In progressive rounds, top & bot delimit the range of rows beginning with progressively longer suffixes of Q Slides from Ben Langmead

18 Exact Matching with FM Index If range becomes empty (top = bot) the query suffix (and therefore the query) does not occur in the text Slides from Ben Langmead

19 Backtracking Consider an attempt to find Q = “agc” in T = “acaacg”: Instead of giving up, try to “backtrack” to a previous position and try a different base (much slower) For 50bp reads, need to have ~25bp perfect match “gc” does not occur in the text “g”“g” “c”“c” Slides from Ben Langmead

20 Seq Files Raw FASTQ –Sequence ID, sequence –Quality ID, quality score Mapped SAM –Map: 0 OK, 4 unmapped, 16 mapped reverse strand –XA (mapper-specific) –MD: mismatch info –NM: number of mismatch Mapped BED –Chr, start, end, strand 20 @HWI-EAS305:1:1:1:991#0/1 GCTGGAGGTTCAGGCTGGCCGGATTTAAACGTAT +HWI-EAS305:1:1:1:991#0/1 MVXUWVRKTWWULRQQMMWWBBBBBBBBBBBBBB @HWI-EAS305:1:1:1:201#0/1 AAGACAAAGATGTGCTTTCTAAATCTGCACTAAT +HWI-EAS305:1:1:1:201#0/1 PXX[[[[XTXYXTTWYYY[XXWWW[TMTVXWBBB HWUSI- EAS366_0112:6:1:1298:18828#0/1 16 chr9 9811660 0 255 38M * 0 0 TACAATATGTCTTT ATTTGAGATATGGATTTTAGGCCG Y\]bc^dab\[_U U`^`LbTUT\ccLbbYaY`cWLYW^ XA:i:1 MD:Z:3C30T 3 NM:i:2 HWUSI- EAS366_0112:6:1:1257:18819#0/1 4 * 0 0 * * 0 0 AGACCACATGAAGCTCAAGAA GAAGGAAGACAAAAGTG ece^dddT\cT^c`a`ccdK\c ^^__]Yb\_cKS^_W\ XM:i:1 HWUSI- EAS366_0112:6:1:1315:19529#0/1 16 chr9 1026102 63 255 38M * 0 0 GCACTCAAGGGT ACAGGAAAAGGGTCAGAAGTGTGGCC ^c_Yc\Lc b`bbYdTa\dd\`dda`cdd\Y\ddd^cT` XA:i:0 MD:Z:38 NM:i:0 chr1123450123500+ chr52837461528374615- http://samtools.sourceforge.net/SAM1.pdf

21 Data Analysis Heuristic filtering to identify novel genes for Mendelian disorders 21 Stitziel et al, Genome Biol 2011

22 Genomic Structural Variation 22 Baker et al, Nat Meth 2012

23 Structural Variation Detection BreakDancer Chen et al, Nat Meth 2009 Only look at anomalous read pairs

24 Structural Variation Detection Crest (Wang et al, Nat Meth 2011) –Use soft-clipped reads, kind of like bidir-blast 24

25 Copy Number Variation Detection Change in read coverage 25

26 Representation: VCF Format http://www.1000genomes.org/node/101 26

27 Summary Whole genome and whole exome sequencing –Solution hybrid selection –Specific locus for rare diseases Bioinformatics issues: –Read mapping –SNP, indel detection –Heuristic filtering –Structural variation detection 27


Download ppt "Genome & Exome Sequencing Read Mapping Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520."

Similar presentations


Ads by Google