2. The Molecular Biology of the Gene

3. Identifying the Genetic Material Mendel’s experiments—inherit chromosomes that contain genes The Question now: –What are genes made of? Scientists searching for the answer: –Griffith and Avery –Hershey and Chase

4. Griffith-Avery Experiment: Transformation of Bacteria Controls

5. THE STRUCTURE OF THE GENETIC MATERIAL Experiments showed that DNA is the genetic material –The Hershey-Chase experiment showed that certain viruses reprogram host cells To produce more viruses by injecting their DNA Bacteriophage-virus that infects only bacteria

6. Hershey-Chase Experiment: DNA, the Hereditary Material in Viruses

7. DNA and RNA are polymers of nucleotides DNA is a nucleic acid –Made of long chains of nucleotide monomers

8. Nucleotides of DNA Nucleotides are the monomeric units that make up DNA  3 main parts:  5 carbon sugar—deoxyribose  Phosphate group  Nitrogenous base

9. Nitrogenous bases of DNA Pyrimidines: single- ring structures  Thymine (T)  Cytosine (C) Purines: larger, double-ring structures  Adenine (A)  Guanine (G) http://www.phschool.com/science/biology_place/biocoach/images/transcription/chembase.gif

10. RNA RNA is also a nucleic acid –But has a slightly different sugar –And has the pyrimidine, Uracil (U), instead of T http://www.phschool.com/science/biology_place/biocoach/images/transcription/chembase.gif

11. Discovery of the Double Helix 1953—James Watson and Francis Crick determined the structure of the DNA molecule to be a double helix –2 strands of nucleotides twisted around each other

12. Discovery of the Double Helix Rosalind Franklin contributed to this discovery by producing an X-ray crystallographic picture of DNA –Determined helix was a uniform diameter and composed of 2 strands of stacked nucleotides

14. –The structure of DNA Consists of two polynucleotide strands wrapped around each other in a double helix Figure 10.3C Twist

15. Double Helix Structure Hydrogen bonds between bases –Hold the strands together Each base pairs with a complementary partner –A base pairs with T –G base pairs with C

16. Structure of DNA relates to its Function Structure of DNA is related to 2 primary functions: 1.Copy itself exactly for new cells that are created 2.Store and use information to direct cell activities

17. DNA Complementary Strands Strands run in opposite directions –Anti-parallel

18. If one strand is known, the other strand can be determined Complementary Strands of DNA ACGGTATCCACGGTATCC  G = T = A  C = T 5’  G 3’

20. DNA Replication DNA replication depends on specific base pairing –DNA replication Starts with the separation of DNA strands –Then enzymes use each strand as a template To assemble new nucleotides into complementary strands

21. DNA Replication Replication occurs simultaneously at many sites (replication bubbles) on a double helix  Allows DNA replication to occur in a shorter period of time

22. DNA Replication Process 1.Helicase unwinds the double helix to expose DNA nucleotides http://www.nature.com/nature/journal/v439/n7076/images/439542a-f1.2.jpg

23. DNA Replication Process 2.Primase lays down an RNA primer to provide a 3’ OH group http://www.nature.com/nature/journal/v439/n7076/images/439542a-f1.2.jpg

24. DNA Replication Process 3.DNA polymerase attaches complementary DNA nucleotides to the 3’ end of a growing daughter strand Can only add bases to the exposed 3’-OH group Therefore, DNA Replication always occurs in the 5’→ 3’ direction http://www.nature.com/nature/jour nal/v439/n7076/images/439542a- f1.2.jpg http://www.mun.ca/biochem/courses/3107/images/S tryer/Stryer_F31-23.jpg

25. DNA Replication Process 4.DNA polymerase then removes the RNA primer and replaces it with complementary DNA nucleotides 5.DNA Ligase creates a covalent bond between the DNA fragments http://www.nature.com/nature/jour nal/v439/n7076/images/439542a- f1.2.jpg http://porpax.bio.miami.edu/~cmallery/150/chemistry/sf3x14a.jpg

26. DNA Replication “Problem” DNA Polymerase can only replicate in the 5’→ 3’ direction One of the template strands would require replication in the 3’→ 5’ direction (WON’T WORK) So, one daughter strand is made continuously while the other strand is made in short pieces called Okazaki fragments Overall Direction of Replication-toward the replication fork

27. DNA Replication

28. Assures that daughter cells will carry the same genetic information as each other and as the parent cell.  Each daughter DNA has one old strand of DNA and one new strand of DNA  Semiconservative Replication

29. Checking for Errors 1/1,000,000,000 chance of an error in DNA replication –Can lead to mutations DNA polymerases have a “proofreading” role –Can only add nucleotide to a growing strand if the previous nucleotide is correctly paired to its complementary base If mistake happens, DNA polymerase backtracks, removes the incorrect nucleotide, and replaces it with the correct base

31. Flow of Genetic Information Flow of genetic information from DNA to RNA to protein The DNA genetic code (genotype) is expressed as proteins which provide the physical traits (phenotype) of an organism GCTGCTAACGTCAGCTAGCTCGTAGC GCTAGCGCTTGCGTAGCTAAAGTCGA GCTCGCTTGCGTAGCTAAAGTCGAGC TGCTGCTAACGTCAGCTAGCTCGTAG AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGCT GCTGCTAACGTCAGCTAGCTCGTAGC AGCGCTTGCGTAGCTAAAGTCGAGC, cont. RNAProteins

32. Protein Synthesis Transcription  Process in which a molecule of DNA is copied into a complementary strand of RNA Translation  Process in which the message in RNA is made into a protein

34. Forms of RNA 3 Main Types of RNA 1)mRNA (messenger RNA) – RNA that decodes DNA in nucleus  brings DNA message out of nucleus to the cytoplasm Each 3 bases on mRNA is a “codon” 2)tRNA (transfer RNA) – RNA that has the “anticodon” for mRNA’s codon The anticodon matches with the codon from mRNA to determine which amino acid joins the protein chain 3)rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules

35. Transcription produces genetic messages in the form of RNA Figure 10.9A RNA polymerase RNA nucleotide Direction of transcription Newly made RNA Template strand of DNA Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

36. Transcription 1. Initiation: RNA polymerase (enzyme) attaches to DNA at the promoter and “unzips” the two strands of DNA 2. Elongation: RNA polymerase then “reads” the bases of DNA and builds a single strand of complementary RNA called messenger RNA (mRNA) 3. Termination: When the enzyme reaches the terminator sequence, the RNA polymerase detaches from the RNA molecule and the gene

37. Transcription The code on DNA tells how mRNA is put together. Example: DNA  ACCGTAACG mRNA  UGGCAUUGC Each set of 3 bases is called a triplet or codon (in mRNA) UGG CAU UGC

38. Noncoding segments called introns are spliced out Coding segments called exons are bonded together A 5’cap and a 3’ poly-A tail are added to the ends Eukaryotic RNA is processed before leaving the nucleus Figure 10.10 DNA RNA transcript with cap and tail mRNA ExonIntron Exon Transcription Addition of cap and tail Introns removed Exons spliced together Coding sequence NUCLEUS CYTOPLASM Tail Cap Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

39. Protein Synthesis Transcription Translation  Process in which RNA is used to make a protein

40. In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide The process is aided by tRNAs Transfer RNA molecules serve as interpreters during translation Figure 10.11A Hydrogen bond Amino acid attachment site RNA polynucleotide chain Anticodon Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

41. Ribosomes build polypeptides Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

42. mRNA, a specific tRNA, and the ribosome subunits assemble during initiation Figure 10.13B 1 Initiator tRNA mRNA Start codon Small ribosomal subunit 2 P site Large ribosomal subunit A site Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

43. The mRNA moves a codon at a time relative to the ribosome –A tRNA pairs with each codon, adding an amino acid to the growing polypeptide Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation

44. Translation 1.Initiation: –mRNA molecule binds to the small ribosomal subunit –Initiator tRNA binds to the start codon (AUG— Methionine) in the P-site of the ribosome –The large ribosomal subunit binds to the small one so that the initiator tRNA is in the P-site to create a functional ribosome

45. Translation 2.Elongation: –Codon recognition: anticodon of incoming tRNA molecule, carrying its amino acid, pairs with the mRNA codon in the A-site of the ribosome –Peptide formation: polypeptide separates from the tRNA in the P site and attaches by a peptide bond to the amino acid carried by the tRNA in the A site –Translocation: the tRNA in the P-site now leaves the ribosome, and the ribosome moves along the mRNA so that the tRNA in the A-site, carrying the growing polypeptide, is now in the P- site. Another tRNA is brought into the A-site

46. Translation 3.Termination: –Elongation continues until a stop codon is reached— UAA, UAG, or UGA –The completed polypeptide is released, the ribosome splits into its subunits

48. UCAG U UUU Phenylalanine (Phe)UCU Serine (Ser)UAU Tyrosine (Tyr)UGU Cysteine (Cys) U UUC PheUCC SerUAC TyrUGC Cys C UUA Leucine (Leu)UCA SerUAA STOPUGA STOP A UUG LeuUCG SerUAG STOPUGG Tryptophan (Trp) G C CUU Leucine (Leu)CCU Proline (Pro)CAU Histidine (His)CGU Arginine (Arg) U CUC LeuCCU ProCAC HisCGC Arg C CUA LeuCCA ProCAA Glutamine (Gln)CGA Arg A CUG LeuCCG ProCAG GlnCGG Arg G A AUU Isoleucine (Ile)ACU Threonine (Thr)AAU Asparagine (Asn)AGU Serine (Ser) U AUC IleACC ThrAAC AsnAGC Ser C AUA IleACA ThrAAA Lysine (Lys)AGA Arginine (Arg) A AUG Methionine (Met) or STARTACG ThrAAG LysAGG Arg G G GUU Valine ValGCU Alanine (Ala)GAU Aspartic acid (Asp)GGU Glycine (Gly) U GUC (Val)GCC AlaGAC AspGGC Gly C GUA ValGCA AlaGAA Glutamic acid (Glu)GGA Gly A GUG ValGCG AlaGAG GluGGG Gly G Second Nucleotide First Nucleotide Third Nucleotide

49. An exercise in translating the genetic code RNA DNA Polypeptide Start codon Stop codon

50. Mutations Mutagenesis—creation of mutations Can result from Spontaneous Mutations Errors in DNA replication or recombination Mutagens—physical or chemical agents –High-energy radiation (X-rays, UV light)

51. Types of Mutations Mutations within a gene –Can be divided into two general categories. Base substitution Base deletion (or insertion) –Can result in changes in the amino acids in proteins. Sickle-Cell Disease

52. Substitution Mutations Missense mutation: altered codon still codes for an amino acid, although maybe not the right one Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely –Leads to nonfunctional proteins

53. Insertions and Deletions Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made

54. Although mutations are often harmful, –They are the source of the rich diversity of genes in the living world. –They contribute to the process of evolution by natural selection. Are all Mutations Bad?

55. Ribosome 5’3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA A U C Met Incoming tRNA charged with amino acid A U C Met C C A Trp

56. Ribosome 5’3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA C C A Trp U C A Outgoing “empty” tRNA Met A G A Phe

57. Ribosome 5’3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA C C A Trp Met A G A Phe U C A C C A Trp

58. Ribosome 5’3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA C C A Trp Phe C C A Trp A G A U C A Met

59. Amino acid Incoming tRNA charged with amino acid Ribosome 5’3’ U U C U G G A U G U G G U U C U G G Reading direction mRNA A C C Trp Anticodon A G A Phe A C C Trp A A G Phe Outgoing “empty” tRNA C U A U C A Met