1. Page 1 DAY 2 Theoretical and Methodological Extensions of Competitive Dynamics Research

2. Page 2 TMT Demography & Performance Distress Global Multi-market Competition Inter- organizational Networks Action Awareness Motivation Capability Performance Theoretical Extensions Awareness-Motivation-Capability (AMC) Perspective

3. Page 3 Theoretical Extensions What are most important theoretical or conceptual extensions? Do we better understand “how” or “why” competitive action occurs? Have we moved toward a predictive theory of competitive dynamics? What more do we need?

4. Coke’s Actions Pepsi’s Action Rivalry Competitive Outcomes Industry Characteristics Organizational Characteristics dabecdabec

5. Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Coca-Cola Pepsi Action-Reaction Dyads bbba acce

6. Prior Studies: Action “Repertoires” time Year-End Tallies Coca-Cola Pepsi bbb c b ba ce b

7. Sequence of Competitive Actions time MKT PRICEMKTPRICESVCPROD Sequence of Musical Notes Music as Metaphor for Competitive Behavior

8. Page 8 Notes Pitch Volume Dynamics Duration Voice Like individual competitive actions

9. Page 9 Chords, Arpeggios Harmonic anchor Harmonic interval or proximity Harmonic sequence Like pairs or combinations of competitive actions

10. Page 10 Melody Timing, rhythm Simplicity Movement Predictability Familiarity Phrasing Motif Like a meaningful, coherent series of competitive actions

11. Page 11 Notes Pitch Volume Dynamics Duration Voice Chords, Arpeggios Harmonic anchor Harmonic proximity Harmonic sequence Melody Timing, rhythm Simplicity Movement Predictability Familiarity Phrasing Motif Music as metaphor for competitive behavior

12. Sequences LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;

13. Page 13 Sequences in Competitive Interaction Ordered sample of things Logically unified sequence Succession of market-based decisions Patterns in stream of behaviors Coordinated series of actions Actions in a sequential strategic thrust

14. Coke’s Actions Pepsi’s Action Rivalry Competitive Outcomes Industry Characteristics Organizational Characteristics dabecdabec

15. Page 15 a b c d e cabecabdecabd CokePepsi d aa b e c e b a d b cc Observed Sequence Competitive Actions Over Time

16. Page 16 Total a b c d e cab d acaadceaad cc a a e a d b aaaa 7 1 1 2 2 Observed Sequence of Pepsi’s Competitive Actions Pepsi Strategic Simplicity

17. Page 17 Total a b c d e eab d acacdecbdd e c d a cc d b b a e a 3 2 2 3 3 Observed Sequence of Coke’s Competitive Actions Coke Strategic Complexity

18. Page 18 a b c d e caeecabdecabd d e aaa d b b e cc c Pepsi in time 1 Pepsi in time 2 b Observed Sequence Pepsi Strategic Predictability

19. Page 19 a b c d e cabecabdecabd Coke in time 1 d e b aaa d b b e c c c Coke in time 2 Observed Sequence Coke Strategic Unpredictability

20. Page 20 a b c d e cab e cabdecabd Pepsi d aa b e c e b a d b c c Observed Sequence Pepsi Strategic Conformity Industry Norm

21. Page 21 a b c d e cabecabdecabd CokeIndustry Norm d aa b e c e b a d b cc Observed Sequence Coke Strategic Non-Conformity

22. Page 22 a b c d e cab d ecabdecabd e c b a c b d b a e c a Observed Sequence of Coke’s Competitive Actions Coke Strategic Chunking – Low Separation Scores

23. Page 23 a b c d e cab d ecabdecabd e c b aaa d bb e cc Observed Sequence of Pepsi’s Competitive Actions Pepsi Strategic Disconnectedness

24. Page 24 ( + )1.0 ----------------------------------------------------------------------------------- (-)1.0 a b c d e cabecabdecabd a Observed Sequence of Competitive Actions Coke Strategic Motif – High Variance of Precedence Scores c d b e

25. Page 25 ( + )1.0 ------------------------------------------------------------ (-)1.0 a b c d e cabecabdecabd a Observed Sequence of Competitive Actions Pepsi Strategic Randomness – Low Variance of Precedence Scores c b d e

26. Page 26 Methodological Extensions What are the most important advances in data, levels of aggregation, measures and analytical methods? Do we now better understand “how” or “why” competitive action occurs? …and how action relates to performance? Have we moved toward a predictive theory of competitive dynamics? What more do we need?

27. Page 27 Advocacy Presentations Three teams – three sets of research articles – Discuss and present (~10 minutes) General idea/phenomenon, research questions, motivation for these studies Theoretical reasoning – Key constructs – General hypothesized relationships General research approach – Data & measures – Analysis approach – Key findings Overall contribution What’s missing? …and… What’s next?