2. Regents Biology 2006-2007 Genetic Engineering Biotechnology

3. Regents Biology We have been manipulating DNA for generations!  Artificial selection – selective breeding  Humans choose parents with desired traits  creating new breeds of animals & new crop plants to improve our food

4. Regents Biology Animal breeding

5. Regents Biology Breeding food plants  “Descendants” of the wild mustard  the “Cabbage family”

6. Regents Biology Breeding food plants Evolution of modern corn (right) from ancestral teosinte (left).

7. Regents Biology A Brave New World

8. Regents Biology The code is universal  Since all living organisms…  use the same DNA  use the same code book  read their genes the same way  REDUNDANCY IN THE CODE – more than one codon for some amino acids

9. Regents Biology Can we mix genes from one creature to another? YES!

10. Regents Biology Mixing genes for medicine…  Allowing organisms to produce new proteins – TRANSGENIC ORGANISMS  bacteria producing human insulin  bacteria producing human growth hormone THIS IN NO WAY BENEFITS THE BACTERIA So why do this? - Fairly easy, cheaper, and less side effects Genetically Modified Organisms (GMOs)

11. Regents Biology Uses of genetic engineering  Genetically modified organisms (GMO)  enabling plants to produce new proteins  Protect crops from insects: BT corn  corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)  Extend growing season: fishberries  strawberries with an anti-freezing gene from flounder  Improve quality of food: golden rice  rice producing vitamin A improves nutritional value

12. Regents Biology How do we do mix genes?  Genetic engineering  find gene – human genome  cut DNA in both organisms – need enz + ATP  paste (splice) gene from one creature into other creature’s DNA producing recombinant DNA  insert new chromosome into organism (transgenic)  organism copies new gene as if it were its own – replication for m______ & m_________  (One cell can pass info on to many others)  organism reads gene as if it were its own  organism produces NEW protein (has that trait): Remember: we all use the same genetic code!

13. Regents Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

14. Regents Biology  DNA “scissors”  enzymes that cut DNA  restriction enzymes  used by bacteria to cut up DNA of attacking viruses (found naturally)  Examples : EcoRI, HindIII, BamHI  cut DNA at specific sites – usually palindromes  enzymes look for specific base sequences Cutting DNA GTAACG|AATTCACGCTT CATTGCTTAA|GTGCGAA Cleavage sites

15. Regents Biology Restriction enzymes  Cut DNA at specific sites - palindromes  leave “sticky ends” – allows for base pairing GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site “sticky ends” – AATT and TTAA

16. Regents Biology Sticky ends  Cut other DNA with same restriction enzymes  Leaves same “sticky ends” on both  can glue (splice) DNA together at “sticky ends” – complementary bases will pair up and H-bonds form GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

17. Regents Biology TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC Why mix genes together?  Gene produces protein in different organism or different individual aa “new” protein from organism ex: human insulin from bacteria human insulin gene in bacteria bacteriahuman insulin How can bacteria read human DNA?

18. Regents Biology Bacteria  Bacteria are great!  one-celled organisms  reproduce by mitosis  Natural cloning makes copies of gene  easy to grow, fast to grow  generation every ~20 minutes

19. Regents Biology  Single circular chromosome  only one copy = haploid  no nucleus  Other DNA = plasmids! Bacterial DNA bacteria chromosome plasmids

20. Regents Biology There’s more…  Plasmids  small extra circles of DNA  carry extra genes that bacteria can use  can be swapped between bacteria  bacterial sex!!  rapid evolution = antibiotic resistance  can be picked up from environment

21. Regents Biology How can plasmids help us?  A way to get genes into bacteria easily  insert (splice) new gene into plasmid  insert plasmid into bacteria = vector  bacteria now expresses new gene by making the new protein + transgenic bacteria gene from other organism plasmid cut DNA recombinant plasmid/DNA vector glue DNA - (splice) H-bonds form between “sticky ends” MUST USE SAME RESTRICTION ENZYME

22. Regents Biology Grow bacteria…make more Bacteria reproduce By MITOSIS And Copy DNA harvest (purify) protein for use - Leave some bacteria to continue to reproduce and make more protein transgenic bacteria plasmid gene from other organism + recombinant plasmid vector

23. Regents Biology Applications of biotechnology 1. human insulin 2. human growth hormone 3. gene for pest resistance in plants 4. gene used to alter bacteria to clean up toxic waste 5. protein to dissolve blood clots in heart attack therapy