Download presentation
Presentation is loading. Please wait.
Published bySharleen Hicks Modified over 9 years ago
1
DEVELOPMENT OF A PCR BASED TEST TO DIFFERENTIATE PADDLEFISH AND STURGEON EGGS Scott Cooper, Jill Mader, Sue Kittleson, Valerie Hyde, Marc Rott Biology/Microbiology Department, University of Wisconsin-La Crosse, La Crosse, WI 56401
2
Sample Preparation Eggs kept on ice until freezing at -80 o C Single egg mashed with sterile glass rod in 200 ul buffer (20 mM Tris, 20 mM KCl, 0.5% Tween 20, 5% Chelex, 0.2 mg/ml proteinase K) Samples incubated 1.5 hours at 55 o C Samples incubated 8 minutes at 95 o C Samples centrifuged at 14,000 rpm for 10 minutes An aliquot was removed for PCR amplification (0.01-1 ul)
3
Polymerase Chain Reaction (PCR) Mix together... Sample DNA dNTPs Buffer Taq DNA Polymerase PCR Primers CBL1 TGATGAAATTTTGGCTCACT CBR1 GTGGAAGGCGAAGAATCG 5’ 3’ 95 o C 5’ 3’ 55 o C 5’ 3’ 72 o C 5’ 3’ 5’ CBR1 CBL1
4
Cytochrome b DNA Sequences PCR products from paddlefish, shovelnose sturgeon and lake sturgeon were cloned and sequenced. Shovelnose Lake Paddlefish Lake Table 1. Percent DNA Sequence Identity 86.6% 86.0% 90.8%
5
Restriction Enzyme Digestion Mix together : 1 ul PCR product 8 ul buffer and water 1 ul restriction enzyme Incubate 30 min, 37 o C. Subject sample to agarose gel electrophoresis for 45 minutes. Stain gel with ethidium bromide and photograph.
6
Restriction Mapping Restriction enzymes cut DNA at specific sites. A single change in the sequence of that site will prevent cleavage. Example: HincII cuts GTTAAC in paddlefish cyt b DNA but not GTAAAC in sturgeon cyt b DNA PA SN LK HincII NarI
7
PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp Figure 3. Restriction digest of PCR products with the restriction enzyme HincII. Samples were run on a 3% Methaphor agarose gel.
8
Figure 4. Restriction digest of PCR products with the restriction enzyme NarI. Samples were run on a 1% LE agarose gel. PA uncut PA cut SN uncut SN cut LK uncut LK cut PS uncut PS cut Stds 500 bp 400 bp 300 bp 220 bp 200 bp
9
Conclusions Enough DNA can be isolated from a single fish egg to allow for sucessful PCR amplification. DNA sequence analysis demosnstrates unique genetic markers in paddlefish, and in shovelnose, pallid and lake sturgeon. This assay will allow the species identification of a single egg within one day. To date this assay has been tested on more than thirty fish, from all over the country, with no observed discrepancies in the assay.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.