Presentation is loading. Please wait.

Presentation is loading. Please wait.

What causes LCA2 blindness?

Published byMoses Harrington Modified over 9 years ago

Similar presentations

Presentation on theme: "What causes LCA2 blindness?"— Presentation transcript:

1 What causes LCA2 blindness?
light RPE65 trans-retinal change [Na+] send signal on optic nerve cis-retinal

2 LCA2 blindness: light change [Na+] send signal on optic nerve
trans-retinal change [Na+] send signal on optic nerve cis-retinal trans-retinal

3 Is LCA2 allele dominant or recessive?
RPE65 gene normal allele LCA2 chromosome 1 RPE65 transcription translation no functional protein

4 What is the probability of another LCA2 child?
What are the genotypes? What is the probability of another LCA2 child? Rr rr R = normal RPE65 r = LCA2 1 in 4 chance next child will be blind by age 20

5 How could we prevent or cure this disease?
Rr rr R = normal RPE65 r = LCA2 1 in 4 chance next child will be blind by age 20 What would we need to have in order to do gene therapy?

6 Where can we find the RPE65 gene?
human DNA RPE65 gene Joe cell OK, but now what?

7 Gene cloning Isolate a specific gene of interest Insert into a plasmid
human RPE65 gene Isolate a specific gene of interest Insert into a plasmid Transfer to bacteria Grow bacteria to get many copies Express the protein product Why? Sequence the gene Study the enzyme Understand regulation Genetic screening Gene therapy …etc. plasmid recombinant DNA human RPE65 enzyme E. coli

8 Steps in gene cloning Isolate DNA including YFG
human RPE65 gene Isolate DNA including YFG Join to plasmid vector (ligation) Introduce into host (transformation) Find correct clone Express the protein product ligation plasmid recombinant DNA transformation human RPE65 enzyme E. coli

9 1. Isolate DNA including YFG
Extract from cells Cut into manageable fragments RPE65 gene RPE65 gene human DNA

10 Restriction digest GAATTC CTTAAG GAATTC CTTAAG GAATTC CTTAAG human DNA
cloning vector (plasmid)

11 2. Join to plasmid vector (ligation)
restriction fragment AATTC G CTTAA “sticky” ends cloning vector (plasmid)

12 2. Join to plasmid vector (ligation)
DNA ligase GAATTC CTTAAG GAATTC CTTAAG recombinant plasmid what’s missing? what enzyme should we use?

13 2. Join to plasmid vector (ligation)
+ human DNA fragments plasmid library

14 3. Introduce into host (transformation)
+ recombinant DNA E. coli CaCl2 or electric shock recombinant E. coli

15 3. Introduce into host (transformation)

16 3. Introduce into host (transformation)
Select cells that have plasmid by antibiotic resistance agar plate with ampicillin

17 4. Find the correct clone How do we know which of all these colonies came from a cell that took up a plasmid carrying RPE65?

18 This won’t work. Why not? 4. Find the correct clone
Enzyme assay for RPE65 trans- retinal HPLC This won’t work. Why not? proteins from lysed bacteria

19

20 Why my clones can’t make RPE65 protein:
RPE65 gene has introns; bacteria can’t splice Expression signals: Transcription: bacteria need -10 and -35 human gene has TATA, enhancers, etc. Translation: bacteria need Shine-Dalgarno human gene won’t have it ? ? ATG TAG enhancers TATA

21 cDNA cloning: DNA copy of RNA
Spliced mRNA → coding sequence with no introns DNA nucleus mRNA cytoplasm mature RNA AAAAAAAAAAAAAAA reverse transcriptase Why does it have to be DNA? DNA

22 cDNA cloning Purify mRNA: from what kind of cells?
from where in the cell? AAAAAAAAAA mRNA

23 cDNA cloning Add reverse transcriptase to make cDNA AAAAAAAAAA TTTTTTT

24 cDNA cloning Add reverse transcriptase to make cDNA

25 cDNA cloning Ligate to a plasmid vector +

26 cDNA cloning Transform into E. coli Find correct clone cDNA library
Now could we express the protein product??

27 Expression vector Plasmid with transcription and translation signals
-10 -10 -35 EcoRI S-D RPE65 cDNA -35 EcoRI S-D expression vector

28 4. Find the correct clone Enzyme assay for RPE65 HPLC trans- retinal
proteins from lysed bacteria

29 Cloned gene is ready for use!
purify plasmid DNA sequencing express protein etc.

30 Cloning by PCR Polymerase chain reaction
If DNA sequence is known, amplify specific gene directly PCR RPE65 gene human DNA

31 Cloning by PCR Human DNA RPE65-specific 20-nt primers
Taq DNA polymerase dNTPs part of RPE65 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG 3′ TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCTCC heat 5′ ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGAGG TTTGACACCT 5′ primer TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAAC heat 5′ CCAGGTTGAG TACAGATAGGTCCAACTCGTAGGACGACCACCAATGTTCTTGACAAACTTTGACACCT 5′ primer CATCCTGCTGGTGGTTACAAGAACTGTTTGAAACTGTGGA

32 Cloning by PCR

33 + Cloning by PCR Once amplified, ligate and transform as before
plasmid vector amplified copies of RPE65 gene

34 Genetic engineering

35 Genetic engineering Modified microorganisms:
Insulin, growth hormone, clotting factors, EPO… HPV vaccine Ethanol from cellulose Oil-eating bacteria Modified plants and animals BT corn Roundup-ready soybeans Golden rice Modified humans Gene therapy

36 Unlimited possibilities
Recombinant DNA technology: Unlimited possibilities Many questions

Download ppt "What causes LCA2 blindness?"

Similar presentations

Production of Human Growth Hormone in Genetically Modified Bacteria

Production of Human Growth Hormone in Genetically Modified Bacteria
Chapter 20 DNA Technology & Genomics. Slide 2 of 14 Biotechnology Terms Biotechnology Process of manipulating organisms or their components to make useful.

Chapter 20 DNA Technology & Genomics. Slide 2 of 14 Biotechnology Terms Biotechnology Process of manipulating organisms or their components to make useful.
What do you notice about these phrases?

What do you notice about these phrases?
Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. From Gene to Protein (an overview)

Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. From Gene to Protein (an overview)
DNA Technology & Gene Mapping Biotechnology has led to many advances in science and medicine including the creation of DNA clones via recombinant clones,

DNA Technology & Gene Mapping Biotechnology has led to many advances in science and medicine including the creation of DNA clones via recombinant clones,
Aulani GE Presentation 3 Gene Cloning Aulanni’am Biochemistry Laboratory Chemistry Department Brawijaya University

Aulani "GE" Presentation 3 Gene Cloning Aulanni’am Biochemistry Laboratory Chemistry Department Brawijaya University
Dolly the sheep (1997-2003) 1. Animal and human cloning 2. Gene cloning.

Dolly the sheep ( ) 1. Animal and human cloning 2. Gene cloning.
Recombinant DNA Technology. Recombinant DNA Technology combines DNA from different sources – usually different species Utility: this is done to study.

Recombinant DNA Technology. Recombinant DNA Technology combines DNA from different sources – usually different species Utility: this is done to study.
LEQ: HOW DO WE SPLICE NEW GENES INTO DNA? 12.1 to 12.7 and 12.18.

LEQ: HOW DO WE SPLICE NEW GENES INTO DNA? 12.1 to 12.7 and
Gene technology - what is it? - what is it used for? - how does it work?

Gene technology - what is it? - what is it used for? - how does it work?
Biotechnology. Cloning  Production of genetically identical copies of DNA, cells or organisms Asexual reproduction  Gene therapy – genes used to modify.

Biotechnology. Cloning  Production of genetically identical copies of DNA, cells or organisms Asexual reproduction  Gene therapy – genes used to modify.
Recombinant DNA Technology

Recombinant DNA Technology
Ch 12. Researchers can insert desired genes into plasmids, creating recombinant DNA and insert those plasmids into bacteria Bacterium Bacterial chromosome.

Ch 12. Researchers can insert desired genes into plasmids, creating recombinant DNA and insert those plasmids into bacteria Bacterium Bacterial chromosome.
Biotechniques.

Biotechniques.
Genetic Engineering Biotechnology Molecular Cloning Recombinant DNA.

Genetic Engineering Biotechnology Molecular Cloning Recombinant DNA.
Genetic Engineering learning outcomes

Genetic Engineering learning outcomes
Concept 20.1: DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare well-defined segments.

Concept 20.1: DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare well-defined segments.
AP Biology 2005-2006 Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need.

AP Biology Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need.
Chapter 20: Biotechnology. Essential Knowledge u 3.a.1 – DNA, and in some cases RNA, is the primary source of heritable information (20.1 & 20.2)

Chapter 20: Biotechnology. Essential Knowledge u 3.a.1 – DNA, and in some cases RNA, is the primary source of heritable information (20.1 & 20.2)
Warm Up Create a Vocabulary 4 Square As we identify the terms in our lesson: 1.Define the term 2. Give an example 3. Draw a picture to help you remember.

Warm Up Create a Vocabulary 4 Square As we identify the terms in our lesson: 1.Define the term 2. Give an example 3. Draw a picture to help you remember.

Similar presentations

Ads by Google