1. Recombinant DNA Technology

2. Further Historical Perspective
Geneticists have known for a long time how to isolate DNA from cells.
Geneticists have known for a long time how to chop DNA into small pieces.
What geneticists did not know how to do until the early 1970s was to replicate small fragments of DNA.

3. 1970s Breakthrough
The discovery of the restriction enzyme (or restriction endonuclease).

4. Properties of RE
Cut double-stranded DNA at specific target sites.
Allow fragments of DNA that have been cut with the same RE to be rejoined.

6. Animation
Recombinant DNA_Animation_1
Recombinant DNA_Animation_2

7. The joining of two DNA fragments by DNA ligase produces a recombinant DNA molecule

12. Therefore, eukaryotic DNA could be propagated in prokaryotic cells
Therefore, eukaryotic DNA could be propagated in prokaryotic cells. A great breakthrough!!!!!

13. Carriers of foreign DNA are Vectors:
Most carriers are
1. Plasmids
2. Bacteriophages (viruses)

14. A bacteriophage is a virus that infects a bacteria.

16. Introduction to PCR PCR (polymerase chain reaction)
PCR is a means to enhance/replicate the amount of DNA collected (in vitro)
* p r c

17. PCR Creates more DNA for Study
PCR Animation

18. DNA Replication Review:
Add DNA polymerase, all 4 DNA building blocks  ???
5’ CTGACGCTGCTGCATGCTAGCT 3’
3’ GACTACGACGACGTACGATCGA 5’

19. DNA Replication Review:
Primers are required:
5’ CTGACGCTGCTGCATGCTAGCT 3’
CGA 5’
5’ CTG
3’ GACTACGACGACGTACGATCGA 5’

20. DNA Replication Review:
Primers are required:
5’ CTGACGCTGCTGCATGCTAGCT 3’
t a c g a t CGA 5’
5’ CTG a t g c t g
3’ GACTACGACGACGTACGATCGA 5’

25. Introduction to Agarose Gel Electrophoresis

26. Weigh out ~ a gram of agarose.

27. Mix the agarose with 50- 100 ml of buffer.

28. Heat to dissolve the agarose.

29. Assemble the gel tray and comb.

30. Pour the gel.

31. Pick up the DNA sample with a micro-pipettor.

32. Load one DNA sample into each well on the gel.

33. Connect the gel to a low voltage power supply.

34. After completion of the run, add a DNA staining material and visualize the DNA under UV light.

35. Analyze the results.

37. Gel Electrophoresis – demonstration
Ensure you’re plugged into the web ;)

38. Electrophoresis Demo 1 – flash simulation
Electrophoresis Demo 2 – java applet
You need to be hooked to the web for these to work ;)