1. Genetic Engineering

2.  Allows scientists to manipulate the DNA (genome) of living things.  Selective Breeding (original genetic engineering)  Crossing organisms w/desired traits  Selecting traits in animals – used inbreeding Domestic animals; dogs, cows, pigs, goats, sheep, etc.  Growing seeds from plants that had traits prefered Example: the brassica family original plant:

3.  Any guesses?

5.  Mutations are the ultimate source of biodiversity!  When mutations are isolated, they can then be introduced into populations.  Now that we can analyze & manipulate DNA  this can be done on the molecular level!  This can be done between different species! Example: can use bacteria and viruses to insert DNA

6.  Benefits: Recombinant DNA has applications in agriculture, industry, medicine & forensics.  Draw backs: There are ethical, legal, safety and social issues surrounding genetic engineering.

7.  They use the smallest scissors!  To cut DNA into smaller pieces  Called Restriction Enzymes  It’s like using the “search” function.  Copy the following DNA sequence in your BFF.  GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA  Look carefully to find this specific series:  GTTAAC  When you find it, divide the sequence in half between the T and A.  How many occurrences?  How many fragments of DNA?