1. Davidson Day Ateh Neuroscience Centre, Institute of Cell and Molecular Sciences Barts and The London School of Medicine and Dentistry Queen Mary University of London Experimental Neuropathology Module - November 2007 Intercalated Experimental Pathology BSc PCR, Theory and Applications

2. DNA

3. DNA Replication In Vivo DNA replication occurs during cell division DNA Polymerase facilitates replication Different types of DNA polymerase (e.g. I, II & III and those involved in DNA repair) RNA polymerase for transcription High fidelity DNA synthesis is due to proof reading (only one error per 1  10 9 nucleotides)

4. Or in vitro DNA replication Polymerase Chain Reaction A DNA polymerase (Taq) is used to make many copies of a short length of DNA defined by primers in a test tube Thermus Aquaticus was discovered in the Yellowstone (USA) hotsprings in the 1960’s and thrives at around 72°C Taq DNA polymerase works optimally at 72°C Critically it is not denatured at 94°C (thermostable) Revolutionised by Kary Mullis in the 1980’s whilst he was working for a biotechnology company He received the 1993 Nobel Prize in Chemistry for his work ONE OF THE MOST IMPORTANT MOLECULAR BIOLOGY TECHNIQUES PCR originally a slow, labour intensive process that required the addition of fresh DNA Polymerase every replication round Gene cloning (recombinant DNA techniques) developed in the 1970’s

5. PCR Mix Template DNA Buffer (with Mg 2+ ) Nucleotides (dNTPs) Taq DNA Polymerase (or other thermostable DNA polymerase) Primers

6. Double Stranded DNA Single Stranded DNA Denaturing DNA template Complimentary binding forward and a reverse primers (20-30 oligonucleotides) PCR Mechanisms

7. Melting 94 o C Melting 94 o C Annealing Primers 50 o C Extension 72 o C Temperature 100 0 50 Time 30x 5’3’ 5’ 3’5’ 3’ 5’ 3’5’ 3’ 5’ 3’5’ 3’ 5’3’ 5’ PCR

8. Melting 94 o C Melting 94 o C Annealing Primers 50 o C Extension 72 o C Temperature 100 0 50 Time 30x 5’3’ 5’ 3’5’ 3’ 5’ 3’5’ 3’ 5’ 3’5’ 3’ 5’3’ 5’ PCR

9. Fragments of defined length 5’ PCR Strands that are too long double in size whereas strands that are just right increase exponentially

10. 0 Cycles Number 1 3 8 2 4 1 2 4 16 5 32 6 64 DNA Amplification

11. Theoretically, the number of DNA fragment copies obtained can be calculated Yield = 2 n  y Where y is the initial number of DNA copies and n is the number of thermal cycles = 4,294,967,296,000 If you start with 1000 copies, how many copies are made in 32 cycles? 2 n x y = 2 32 x 1000 = 4,294,967,296 x 1000 PCR Yield

12. Thermal Cyclers

13. Challenges Fidelity of the Reaction Taq DNA polymerase lacks the proof-reading activity present in other polymerases Taq makes 1 error per 1  10 4 nucleotides (remember, 1 per 1  10 9 nucleotides in vivo) Thus, a 400 base pair target will contain an error in 33% of molecules after 20 cycles Error distribution will be random Does not matter if PCR product is for sequencing or to be cut with restriction enzymes Does matter if you want to clone the product (use proof-reading thermostable enzyme) Optimising the PCR Reaction The amount of template and polymerase Annealing temperature of the primers and their design The concentration of Mg 2+ in the reaction The extension time and temperature The denaturing and annealing times

14. The use of PCR PCR is a DNA ‘amplification’ method, many copies of any DNA template can synthesised One starting DNA template can be amplified in to an infinite number of copies “Amplified” fragments of DNA can be sequenced, cloned, probed or sized using electrophoresis Defective genes can be amplified to diagnose illnesses Genes from pathogens can be amplified to identify them (e.g. HIV) Amplified fragments can act as genetic fingerprints using restriction enzymes (nucleases cut, shorten or degrade DNA, Ligases join DNA, polymerases make DNA copies)

15. PCR Practical Example Genotyping Loa mice +/+Loa/+ T-to-A transversion in the Dnchc1 gene that results in residue 580 changing from phenylalanine (TTC) to tyrosine (TAC)

16. PCR Practical Example Genotyping Loa mice DNA prep from mouse tail Biopsies Cut 0.8-1.0 cm of mice tail (or equivalent mass of other parts), divide into small pieces and transfer into Eppendorf tube Add 300  l of Lysis buffer and 3  l of proteinase K. Incubate tubes at 55  C overnight (lysis buffer- 100mM Tris-HCl pH8.0, 5mM EDTA, 0.2% SDS, 200mM NaCl, Proteinase K stock is 20mg/ml New England Biolabs) and leave to digest overnight Vortex each tube well. Spin 10-15 min to pellet hair etc… Pour supernatant into empty Eppendorf tube Dilute 4  l in 200  l H 2 O and use 2  l of this in 20  l PCR reactions for genotyping

17. PCR Practical Example Genotyping Loa mice PCR Mix per tube HotStar Taq master mix (Qiagen) 10ul MDN-Int7-F (10 uM) 2 ul MDN2064-R (10 uM) 2 ul H2O 4 ul ----- 18 ul + 2ul of 1:50 diluted DNA template Thermocycler 1) 95C15min 2) 95C30S 3) 62C30S 4) 72C1min 5) Go to 2, 35 times 6) 72C10min 7) 16CHold

18. PCR Practical Example Genotyping Loa mice TGCTGCTGAGCTGCGTCCTAGTGCTGTGTGCTCTCCTGTTTTCATTCCCTCTTCACAT TCATTAGTTCTTTCCTTTAAGTATACACACACACACACACACACACACAGTAAAGACA GAAGTCTGCAGGGAGATCCTTATAGTGTGCTCATGGCTGAATTGTGATGATAGAGTCC TAAAGGCCTAGAAGTCAGCATTGATGCAAGAATCCTGTGCTGTGCCTGTGACAGAAAA ACGTCATTTGCAGCTATGTTTTGTTCCAAACCTTTTGTTTTAGGTCACAGCAGTCGCA CAACAGAACCAAGGAGAAGCACCTGAACCCCAAGACATGAAAGTGGCCGAGGTGCTCT TTGATGCTGCCGACGCCAACGCCATTGAGGAGGTGAACCTGGCCTACGAGAATGTCAA GGAAGTCGATGGTCTGGATGTTTCCAAAGAAGGGACGGAAGCCTGGGAGGCCGCGATG AAGAGATACGATGAGAGGATCGACCGTGTGGAGACCCGCATCACCGCCCGCCTCCGAG ATCAGCTCGGCACGGCCAAGAATGCCAATGAGATGT T CAGGATTTTCTCCAGGTTCAA TGCACTGTTCGTCCGCCCACACATCCGAGGGGCCATTCGTGAATACCAGACCCAGCTG ATCCAACGTGTGAAAGATGACATCGAATCTCTGCACGACAAGTTCAAGGTCCAGTACC CGCAAAGCCAAGCTTGTAAAATGA Forward Primer Reverse Primer T-to-A change Amplified fragment is 696 bp long

19. PCR Practical Example Genotyping Loa mice PCR Product Use agarose gels (typically 2% w/v) Incorporate ethidium bromide or other DNA dye PCR Product

20. PCR Practical Example Genotyping Loa mice PCR Product Digestion Digestion with RsaI (GT|AC) at 37°C for 2 hrs 672bp 537bp135bp24bp Wt++ Loa/Loa+++ +/Loa++++

21. PCR Practical Example Genotyping Loa mice PCR Product Digestion wtLoa/wtLoa/Loa 672 bp 537 bp 24 bp 135 bp

22. Further PCR Quantitative (Real-Time) PCR (Q-PCR) Reverse Transcription PCR (RT-PCR) Multiplex-PCR Helicase Dependant Amplification (HAD) END Examples