1. Crime Scene Investigation Science in Motion Cedar Crest College

2. Forensic Science in Popular Media

3. On TV In Reality Interrogate suspects, thus they kick down doors Make judgments about guilt or innocence Operate independently of other investigators – For instance, go to crime scenes without permission Never interrogate suspects, often go to crimes scenes long after the crime Should never make judgments about guilt or innocence Work as part of an investigative team and usually in a subordinate role (police are ultimately in charge)

4. On TV In Reality Usually have multiple expertise Act like detectives – Ask “why” – why would someone do this and not that – Rely on hunches Get DNA results in a day Usually do not have multiple expertise Deal only with observable and quantifiable phenomena to reach theories and conclusions Don’t get DNA results in a day

5. What is Forensic Science? The Application of Science to the Law.

6. Scope of Forensic Science Forensic Medicine – Deals with application of medical knowledge to legal questions Birth/death certificates, reports infectious diseases, medical testimony in court Forensic Anthropology – Works with forensic pathologist at crime scene determines age, sex, ancestry, other facts in conjunction with body or skeletal remains Forensic Odontology Questioned Document Examination Criminalistics

7. What is Criminalistics? Application of physical, chemical, and biological methods for analysis of physical evidence taken from criminal investigations that is Locardian in nature.

8. Locard Exchange Principle “Every time two objects come into contact, a transfer of physical evidence occurs, and therefore creates a record of the action” This is the guiding principle of criminalistics

9. Role of Criminal Investigation Participants Question Police/ ADA Medical Examiner Criminalist Who? *** How? *** * Why? ***

10. Forensic Biology Commonly referred to as “DNA Testing” Serological and DNA analyses of physiological fluids for the purpose of identification and individualization

11. Sources of Biological Evidence Blood Semen Saliva Urine Hair Teeth Bone Tissue

12. Uses of Forensic DNA Testing Forensic cases - matching suspect with evidence Paternity testing - identifying father Historical investigations Missing persons investigations Mass disasters (i.e. 9/11) Convicted felon DNA databases

13. How is DNA used in forensic analysis? Every single cell in our body contains DNA 99.9% of human DNA is the same in everyone Only 0.1% of our DNA is unique – Each human contains 3 billion DNA base pairs – Our unique DNA, 0.1% of 3 billion, amounts to 3 million base pairs. This provides us profiles that accurately identify a person (with the exception of twins, who share 100% identical DNA)

14. Crime Scene Lab You are Forensic Scientists! As a forensic scientist, how do you work with these tiny molecules that you cant see? – Analyzing DNA samples from a crime scene using two methods Gel Electrophoresis STR (Short Tandem Repeat ) Analysis

15. Gel Electrophoresis This process uses electricity to separate DNA fragments by size as they migrate through a gel matrix In an electric current the negatively charged DNA moves toward the positive pole in the electrophoresis chamber Smaller DNA fragments move faster and further over a given period of time than do larger fragments. This is how DNA fragments can be separated by size in an agarose gel

16. STR ( Short Tandem Repeat) Analysis Short tandem repeat (STR) technology is a forensic analysis that evaluates specific regions (loci) that are found on nuclear DNA The variable (polymorphic) nature of the STR regions that are analyzed for forensic testing intensifies the discrimination between one DNA profile and another. – For example, the likelihood that any two individuals (except identical twins) will have the same 13-loci DNA profile can be as high as 1 in 1 billion or greater.

17. STR’s STRs are regions of DNA where short sequences, usually between 2- 6 basepairs (bp), are repeated side-by-side STR’s are found surrounding the chromosomal centromere (structural center of the chromosomes)

18. FBI’s CODIS DNA Database (Combined DNA Index System) The Federal Bureau of Investigation (FBI) has chosen 13 specific STR loci to serve as the standard for CODIS. The purpose of establishing a core set of STR loci is to ensure that all forensic laboratories can establish uniform DNA databases and, more importantly, share valuable forensic information

19. 13 CODIS Core STR Loci with Chromosomal Positions CSF1PO D5S818 D21S11 TH01 TPOX D13S317 D7S820 D16S539D18S51 D8S1179 D3S1358 FGA VWA AMEL

20. Each person has 2 copies of each chromosome so each person has 2 alleles at each locus Locus or Loci – Refers to the location on the chromosome Allele – An alternative form of a gene (one member of a pair) that is located at a specific position on a specific chromosome – For STR’s The allele is the number of repeats

21. Paternal Chromosome 5 CCAGATAGATAGATAGATAGATCC Maternal Chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATCC Example Locus: D5S818 Alleles: 5, 7

22. STR Analysis 12345678910111213 vWAF13A01THO1FESFPSD16S539HPRTBTPOXLPLD7S280D5S818D13S317F13BCSF1PO 11,124,68,912, 138,1011, 116,77,96,87,1114, 158, 86,7

23. Forensic Case File #24857 Death of Mrs. Lucy Bell The Timeline The Evidence The Suspects Scientific investigation using biological evidence