1. Self-Organizing Bio- structures NB2-2009L.Duroux

2. Lecture 3 Self-Assembly in nucleic acids

3. DNA & RNA folding

4. What is RNA? Aside of being DNA’s “messenger”, RNA performs functions itself Aside of being DNA’s “messenger”, RNA performs functions itself RNA secondary structure is related to mRNA stability & RNA functions RNA secondary structure is related to mRNA stability & RNA functions RNA folding can be predicted & the effects of mutations modeled RNA folding can be predicted & the effects of mutations modeled

5. RNA Primary Structure RNA chain directionality: 5'  3' Backbone carries charge (-e) on each nucleotide Formation of an RNA structure requires cations (-e) 5' 3' Structure of RNA backbone

6. Four Types of Bases Adenine (A) Guanine (G)Cytosine (C) Uracil (U) PurinesPyrimidines

7. Watson-Crick canonical base pair Base-Pairing: a famous case of molecular self-assembly AU G C

8. What does RNA do?

9. The Central Dogma DNA pre mRNA mRNA protein transcription splicing translation mRNA ribosome tRNA

10. RNAs are Critical to Cellular Functions Messenger RNA (mRNA) codes for protein Small nuclear RNAs (snRNA) splice mRNA in nucleus Transfer RNA (tRNA) carries amino acid to ribosome Ribosomal RNA (rRNA) is the integral part of the ribosome Small interfering RNA (siRNA) mRNA turn-over, defense mechanism Micro RNA (miRNA) Gene expression regulation

11. Some biological functions of non-coding RNA snRNA: RNA splicing, telomere maintenance, transcription regulation snRNA: RNA splicing, telomere maintenance, transcription regulation miRNA: translational control (down regulation) miRNA: translational control (down regulation) siRNA: RNA interference, gene specific down regulation siRNA: RNA interference, gene specific down regulation Guide RNAs: RNA editing (mitochondria protozoa) Guide RNAs: RNA editing (mitochondria protozoa) Ribozymes: Catalysis in ribozomes Ribozymes: Catalysis in ribozomes  The function of the RNA molecule depends on its folded structure

12. RNA Structure(s)

13. The RNA Helix ssRNA forms A-helix: Grooves Binding sites

14. RNA secondary structure Defined by base- pairing Form short helical structures U

15. Base pairing in RNA: not necessarily canonical!

16. Torsion Angles define 3D structure We need 7 torsional angles per nucleotide to specify the 3D structure of an RNA P O c P O c c each bond ~ 1.5 Å nucleotide structure

17. Torsion angles are like rotamers of protein side chain

18. RNA specific folds U U C G U A A U G C 5’ 3’ 5’ G A U C U U G A U C 3’ STEM LOOP The RNA molecule folds on itself. The RNA molecule folds on itself. The base pairing is as follows: The base pairing is as follows: G C A U G U G C A U G U hydrogen bond hydrogen bond

19. RNA Secondary Structure Motifs Hairpin loop Junction (Multiloop) Bulge Loop Single-Stranded Interior Loop Stem Image– Wuchty Pseudoknot

20. Secondary structure motifs and symbols Secondary Structure Contact (Base Pair) Tertiary Structure Contact (Base Pair)

21. RNA Pseudoknot

22. Example of RNA tertiary structure: tRNA

23. RNA Folds & Function

24. RIBOZYMES Catalytic RNA Catalytic RNA Can work alone (Mg 2+ ) or with proteins Can work alone (Mg 2+ ) or with proteins Therapeutic applications? Therapeutic applications?

25. Control of iron levels by mRNA secondary structure G U A G C N N N’ C N N’ 5’3’ conserved Iron Responsive Element (IRE) on mRNA Recognized by Iron Responsive Protein (IRP1, IRP2) when Fe deficiency

26. IRP1/2 5’ 3’ F mRNA 5’ 3’ TR mRNA IRP1/2 F: Ferritin = iron storage TR: Transferrin receptor = iron uptake IRE Low Iron IRE-IRP inhibits translation of Ferritin IRE-IRP Inhibition of degradation of TR High Iron IRE-IRP off -> Ferritin translated Transferrin receptor degraded

27. Sequence Similarity%ID = 34% gurken AAGTAATTTTCGTGCTCTCAACAATTGTCGCCGTCACAGATTGTTGTTCGAGCCGAATCTTACT 64 Ifactor ---TGCACACCTCCCTCGTCACTCTTGATTTT-TCAAGAGCCTTCGATCGAGTAGGTGTGCA-- 58 * * *** ** *** *** * * ***** * * Structural Similarity H St I1 B I2 H St I1 B I2 Gurken : (miRNA controlling development) 64nt stem loop I Factor : (retrotransposon) 58nt stem loop Structure-based similarity

28. RNA Folding & Predictions

29. Goal: To predict of an RNA from its sequence from: structure stability folding kinetics Goal: To predict function of an RNA from its sequence from: structure stability folding kinetics Ultimate goal: To predict RNA function from its sequence RNA folding predictions

30. Folding Free Energy of Secondary Structure Folding free energy: ΔG = G ( secondary structure) - G ( ) ΔG = ΔH – T ΔS

31. RNA PROTEIN PROTEIN types of sidechains: 420 backbone:72 secondary structure: helices α, β, …… # of folded states: often > 1 usually 1 folding driving force: base stacking specific H, Ф nonspecific secondary structure stability: stability: stable without tertiary (7bp ~10 kcal/mol) unstable w/t tertiary (ΔG tot ~10 kcal/mol) (ΔG tot ~10 kcal/mol) folding pathway: folding pathway: multistate, hierarchical usually kinetically controlled usually 2-state usually thermodynamically controlled electrostatics: electrostatics: highly charged variable variable

32. Applications for RNA folding predictions Explain why non-(protein) coding regions are conserved Explain why non-(protein) coding regions are conserved Viral RNA packing inside capsid Viral RNA packing inside capsid Prediction of functional RNAs Prediction of functional RNAs Identify similarity, not by sequence but by structure Identify similarity, not by sequence but by structure

33. B A conversion is slow as compared with the translational process Conformation B is kinetically trapped. Conformation B is kinetically trapped. Why Study RNA Folding Kinetics? Kinetics is tied to Function

34. Ion-Dependence of RNA folding

35. H 2 O and metal ions are integral parts of nucleic acid structure

36. [Na + ] stabilizes secondary structure [Na + ] by 10 folds Tm by 3.8 C [Na + ] by 10 folds Tm by 3.8 C From Tinoco & Bustamante,JMB (1999) 273,271

37. Multivalent Ions Stabilize Tertiary Fold Pseudoknot

38. [Mg 2+ ] Stabilization From Tinoco & Bustamante,JMB (1999) 273,271 Na + = 200mM + 50

39. RNA conformational changes are ion- dependent tRNA

40. RNA folding kinetics strongly depends on ions Na + Secondary structure Mg 2+ Tertiary structure Metal ion binding sites can be formed before, during, or after the formation of the tertiary structure

41. DNA structure

42. DNA Stabilization--H-bonding between DNA base pair stacks

43. Advantages to Double Helix Stability---protects bases from attack by H 2 O soluble compounds and H 2 O itself. Stability---protects bases from attack by H 2 O soluble compounds and H 2 O itself. Provides easy mechanism for replication Provides easy mechanism for replication

44. Formal geometrical models for describing shape of Helix Allows for molecular modeling based on primary structure Allows for molecular modeling based on primary structure Based on Free-energy computations and minimization algorithms Based on Free-energy computations and minimization algorithms Useful to predict impact of sequence composition or mutations (non-canonical base- pairing) on helical structure Useful to predict impact of sequence composition or mutations (non-canonical base- pairing) on helical structure

45. Parameters that define base pairs 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson

46. Parameters that define sequential base pair steps 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson

47. Parameters that relate base pair to the helical frame 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson

48. Physical Structure (cont’d) Chains are anti-parallel (i.e in opposite directions) Chains are anti-parallel (i.e in opposite directions) Diameter and periodicity are consistent Diameter and periodicity are consistent 2.0 nm 2.0 nm 10 bases/ turn 10 bases/ turn 3.4 nm/ turn 3.4 nm/ turn Width consistent because of pyrimidine/purine pairing Width consistent because of pyrimidine/purine pairing

49. Physical Structure (cont’d)

50. G-C Content A=T, G=C, but AT≠GC A=T, G=C, but AT≠GC Generally GC~50%, but extremely variable Generally GC~50%, but extremely variable Examples: Examples: Slime mold~22% Slime mold~22% Mycobacterium~73% Mycobacterium~73% Distribution of GC is not uniform in genomes Distribution of GC is not uniform in genomes

51. CONSEQUENCES OF GC CONTENT GC slightly denser: GC slightly denser: Higher GC DNA moves further in a gradient Higher GC DNA moves further in a gradient Higher number of base pairs : more stable DNA, i.e. the strands don’t separate as easily. Higher number of base pairs : more stable DNA, i.e. the strands don’t separate as easily.

52. FORMS OF DNA

53. B-form A-form Z-form DNA forms

54. A-DNA vs. B-DNA B-DNA is the preferred conformation in vivo A-formB-form dehydrated hydrated bp/turn10.910.0 helical twist angle 33.1°35.9° bp-bp rise 2.9Å3.4Å

55. A “regular” helix contains two similar grooves

56. Asymmetric attachment of DNA bases to backbone creates unequally sized grooves

57. Major and minor grooves in B-DNA and A-DNA

58. The edges of DNA base pairs can form hydrogen bonds to protein side chains

59. Supercoiling

60. Cruciform Structures Another adaptation to supercoiling Associated with palindromes

61. DNA is Dynamic Like proteins, DNA has tertiary structure Like proteins, DNA has tertiary structure Why so many deviations from normal conformation? Why so many deviations from normal conformation? Effects on transcription (gene expression) Effects on transcription (gene expression) Enhances responsiveness Enhances responsiveness May also serve in packaging May also serve in packaging NOTE: most cellular DNA exists as protein containing supercoils NOTE: most cellular DNA exists as protein containing supercoils

62. DNA packaging in chromosomes

63. A T T A G C C G G C TATA T A G C C G G C T A A T Packaging DNA Histone proteins Histone octamer B DNA Helix 2 nm

64. A T T A G C C G G C TATA T A G C C G G C T A A T Packaging DNA Histone proteins B DNA Helix Histone octamer 2 nm

65. A T T A G C C G G C TATA T A G C C G G C T A A T Packaging DNA Histone proteins Histone octomer Nucleosome 11 nm B DNA Helix 2 nm

66. Packaging DNA A T T A G C C G G C T A A T

67. Packaging DNA A T T A G C C G G C T A A T

68. Packaging DNA A T T A G C C G G C T A A T Protein scaffold 11 nm “Beads on a string” 30 nm Tight helical fiber Looped Domains 200 nm

69. Packaging DNA G C A T Protein scaffold Metaphase Chromosome 700 nm 11 nm 30 nm 200 nm 2 nm Looped Domains Nucleosomes B DNA Helix Tight helical fiber

70. Replication Chromosomes, Chromatids and Centromeres Centromere Chromosome arm Identical chromatid Chromatid Anaphase A packaged chromosome Two identical chromosomes

71. DNA-binding Proteins Zinc-Finger Leucine-Zipper Helix-Turn-Helix

72. DNA denaturation

73. Denaturation of DNA Denaturation by heating. Denaturation by heating. How observed? How observed? A 260 A 260 For dsDNA, For dsDNA, A 260 =1.0 for 50 µg/ml A 260 =1.0 for 50 µg/ml For ssDNA and RNA A 260 =1.0 for 38 µg/ml For ssDNA and RNA A 260 =1.0 for 38 µg/ml For ss oligos For ss oligos A 260 =1.0 for 33 µg/ml A 260 =1.0 for 33 µg/ml Hyperchromic shift Hyperchromic shift The T at which ½ the DNA sample is denatured is called the melting temperature (T m )

74. Importance of T m Critical importance in any technique that relies on complementary base pairing Critical importance in any technique that relies on complementary base pairing Designing PCR primers Designing PCR primers Southern blots Southern blots Northern blots Northern blots Colony hybridization Colony hybridization

75. Factors Affecting T m G-C content of sample G-C content of sample Presence of intercalating agents (anything that disrupts H-bonds or base stacking) Presence of intercalating agents (anything that disrupts H-bonds or base stacking) Salt concentration Salt concentration pH pH Length Length

76. Renaturation Strands can be induced to renature (anneal) under proper conditions. Factors to consider: Strands can be induced to renature (anneal) under proper conditions. Factors to consider: Temperature Temperature Salt concentration Salt concentration DNA concentration DNA concentration Time Time

77. C o t Curves

78. What Do C o t Curves Reveal? Complexity of DNA sample Complexity of DNA sample Reveals important info about the physical structure of DNA Reveals important info about the physical structure of DNA Can be used to determine T m for techniques that complementary base pairing. Can be used to determine T m for techniques that complementary base pairing.

79. Complexity of DNA- Factors Repetitive Sequences Single Copy Genes Single Copy Genes Highly repetitive (hundreds to millions) Highly repetitive (hundreds to millions) Randomly dispersed or in tandem repeats Randomly dispersed or in tandem repeats Satellite DNA Satellite DNA Microsatellite repeats Microsatellite repeats Miniisatellite repeats Miniisatellite repeats Middle repetitive (10- hundreds) Middle repetitive (10- hundreds) Clustered Clustered Dispersed Dispersed Slightly repetitive (2-10 copies) Slightly repetitive (2-10 copies)

80. Highly repetitive sequences Middle repetitive Middle repetitive sequences Unique sequences Renaturation curves of E. coli and calf DNA

81. The End

82. Why Study RNA Folding Stability? mRNA has sufficient time to equilibrate before mRNA has sufficient time to equilibrate before translation is initiated equilibrium stability translation is initiated equilibrium stability Stability is tied to function Stability is tied to function mRNA Ribosome binds here

83. Examples of known interactions of RNA secondary structural elements Pseudo-knot Kissing hairpins Hairpin-bulge contact