1. From Genes to Genomes Jinsong Pang
Tel
Key laboratory of molecular biology epigenetics of MOE

2. Watson and Crick: DNA double helix (1953)
Eukaryotic chromosome SV40 minichromosome

3. Nucleosides
The bases are covalently attached to the 1’ position of a pentose sugar ring, to form a nucleoside
Glycosidic (glycoside, glycosylic) bond R
Ribose or
2’-deoxyribose
Adenosine, guanosine, cytidine, thymidine, uridine

4. Bases in DNA purines pyrimidines adenine guanine N9 cytosine N1
thymine

5. BASES NUCLEOSIDES NUCLEOTIDES Adenine (A) Guanine (G) Cytosine (C)
Adenosine
Adenosine 5’-triphosphate (ATP)
Deoxyadenosine
Deoxyadenosine 5’-triphosphate (dATP)
Guanine (G)
Guanosine
Guanosine 5’-triphosphate (GTP)
Deoxyguanosine
Deoxy-guanosine 5’-triphosphate (dGTP)
Cytosine (C)
Cytidine
Cytidine 5’-triphosphate (CTP)
Deoxycytidine
Deoxy-cytidine 5’-triphosphate (dCTP)
Thymine (T)
Thymidine/
Deoxythymidie
Thymidine/deoxythymidie
5’-triphosphate (dTTP)
Uracil (U)
Uridine
Uridine 5’-triphosphate (UTP)

6. Gene
Gene: A molecular unit of heredity of a living organism The segment of DNA specifying production of a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

7. A brief history of genetics
Gene is a "particulate factor" that passes unchanged from parent to progeny. (Mendel 1865)

8. The central dogma: Crick 1958
A gene codes for an RNA, which may code for protein.

9. Eukaryotic genes are often interrupted
Exon is any segment of an interrupted gene that is represented in the mature RNA product. Intron is a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it. RNA splicing is the process of excising the sequences in RNA that correspond to introns, so that the sequences corresponding to exons are connected into a continuous mRNA. Structural gene codes for any RNA or protein product other than a regulator. Transcript is the RNA product produced by copying one strand of DNA. It may require processing to generate mature RNAs.

10. 2.5 Organization of interrupted genes may be conserved
Comparison of the cDNA and genomic DNA for mouse b-globin shows that the gene has two introns that are not present in the cDNA. The exons can be aligned exactly between cDNA and gene.

11. Alternative splicing generates the a and b variants of troponin T
Alternative splicing generates the a and b variants of troponin T. Alternative splicing uses the same pre-mRNA to generate mRNAs that have different combinations of exons.

12. Yeast genes are small, but genes in flies and mammals have a dispersed distribution extending to very large sizes.
Most genes are uninterrupted in yeast, but most genes are interrupted in flies and mammals.

13. Exons coding for proteins are usually short
Exons coding for proteins are usually short. Introns range from very short to very long.

14. Polymorphism (more fully genetic polymorphism): The simultaneous occurrence in the population of genomes showing variations at a given position.
Single nucleotide polymorphism (SNP): The polymorphism (variation in sequence between individuals) caused by a change in a single nucleotide.

15. An exon surrounded by flanking sequences that is translocated into an intron may be spliced into the RNA product.

16. Human chromosomes

17. The contrast between interphase chromatin and mitotic chromosomes
Heterochromatin describes regions of the genome that are permanently in a highly condensed condition are not transcribed, and are late-replicating. May be constitutive or facultative. Euchromatin comprises all of the genome in the interphase nucleus except for the heterochromatin.

18. The importance of packing of DNA into chromosomes
Chromosome is a compact form of the DNA that readily fits inside the cell
To protect DNA from damage
DNA in a chromosome can be transmitted efficiently to both daughter cells during cell division
Chromosome confers an overall organization to each molecule of DNA, which facilitates gene expression as well as recombination

19. Chromosome sequence & diversity
Shape: circular or linear
Number in an organism is characteristic
Copy: haploid, diploid, polyploid
Genomes
3/15/05

20. Genome
Genome: The complete set of sequences in the genetic material of an organism. Transcriptome: The complete set of RNAs present in a cell, tissue, or organism. Proteome: The complete set of proteins that is expressed by the entire genome.

21. Genome & the complexity of the organism
Genome size: the length of DNA associated with one haploid complement of chromosomes
Gene number: the number of genes included in a genome
Gene density: the average number of genes per Mb of genomic DNA
3/15/05

22. Genome & genes Genome: all DNA sequences in a cell
Genes: a stretch of continuous DNA sequence encoding a protein or RNA
C-value is the quantity of DNA in the genome (per haploid set of chromosomes).
C-value paradox refers to the lack of a correlation between genome size and genetic complexity (ie. Lungfish 139Gb vs. human 3Gb)

24. non-coding sequence Repetitive DNA
DNA sequence that does not code for protein or RNA, including
Introns (unique sequence) in genes
DNA consisting of multiple repeats, can be tandemly repeated sequences (e.g. satellite DNA) or interspersed repeats (e.g. Alu element) etc.
Repetitive DNA
Tandem gene clusters :
1. moderately repetitive DNA consists of a number of types of repeated sequence.
2. genes whose products are required in unusually large quantities, e.g. there are copies of rDNA encoding 45S precursor and X100 copies of histone genes.

25. The proportions of different sequence components vary in different genomes.

26. The largest component of the human genome consists of transposons
The largest component of the human genome consists of transposons. Other repetitive sequences include large duplications and simple repeats.

27. Satellite DNA (simple sequence) :
Highly repetitive DNA (>106).
very short (2 to 20-30bp, mini- or micro-), in tandem arrays
concentrated near the centromeres and forms a large part of heterochromatin.
as separate band in buoyant density gradient
no function found, except a possible role in kinetochore binding
Minisatellite repeats are the basis of the DNA fingerprinting techniques

28. Drosophila satellite DNA repeat (several million copies)
5’ – ATAAACTATAAACTATAAACT – 3’
3’ – TATTTGATATTTGATATTTGA – 5’
ACAAACT, 1.1x107 bp, 25% genome
ATAAACT, 3.6x106 bp, 8% genome
ACAAATT, 3.6x106 bp, 8% genome
AATATAG, cryptic
Satellites comprise more than 40% of the genome
Drosophila satellite DNA repeat
(several million copies)

29. Human mitochondrial DNA has 22 tRNA genes, 2 rRNA genes, and 13 protein-coding regions. 14 of the 15 protein-coding or rRNA-coding regions are transcribed in the same direction. 14 of the tRNA genes are expressed in the clockwise direction and 8 are read counter clockwise.

30. CpG islands and the promoters of housekeeping genes

31. Proteins in chromosome
Half of the molecular mass of eukaryotic chromosome is protein
In eukaryotic cells a given region of DNA with its associated proteins is called chromatin
The majority of the associated proteins are small, basic proteins called histones.
Other proteins associated with the chromosome are referred to as non-histone proteins, including numerous DNA binding proteins that regulate the transcription, replication, repair and recombination of DNA.
Nucleosomes: regular association of DNA with histones to form a structure effectively compacting DNA

32. Centromeres, origin of replication and telomere are required for eukaryotic chromosome maintenance
Eukaryotic chromosome duplication & segregation occur in separate phases of the cell cycle
Cell cycle: a single round of cell division
Mitotic cell division: the chromosome number is maintained during cell division

33. Centromeres
Required for the correct segregation of the chromosomes after replication
Direct the formation of kinetochore (an elaborate protein complex) essential for chromosome segregation
One chromosome, one centromere
The size varies (200 bp- >40 kb)
Composed of largely repetitive DNA sequences

34. The centromere Yeast: The region where two chromatids are joined
The sites of attachment to the mitotic spindle via kinetochore
Centromere DNA:
Yeast:
AT-rich (88bp)

35. Mitotic chromosome
Mitotic spindle

36. Mammalian cells: much longer, flanked by satellite DNA
Mitotic chromosome - centromere
Yeast centromere
Mammalian cells: much longer, flanked by satellite DNA

37. The Telomere
Specialized DNA sequences which form the ends of the linear DNA of the eukaryotic chromosome
Contains up to hundreds copies of a short repeated sequence (5’-TTAGGG-3’ in human)
Synthesized by the enzyme telomerase (a ribonucleoprotein) independent of normal DNA replication.
The telomeric DNA forms a special secondary structure to protect the chromosomal ends from degradation

38. Telomere & Telomerase
Repeat sequence: Tetrahymena- TTGGGG; human- TTAGGG

39. A loop structure forms at the end of chromosomal DNA
Telomere: structure
A loop structure forms at the end of chromosomal DNA

40. The eukaryotic mitotic cell cycle

41. Nucleosomes are the building blocks of chromosomes
The nucleosome is composed of a core of eight histone proteins and the DNA (core DNA, 147 bp) wrapped around them. The DNA between each nucleosome is called a linker DNA. Each eukaryote has a characteristic average linker DNA length (20-60 bp)

42. The path of nucleosomes in the chromatin fiber
[图27.17 ：由核小体键组成的部分解缠状态的10nm纤维，照片由Barbar Hamkalo惠赠]
The path of nucleosomes in the chromatin fiber
Nucleosome core
146 bp, 1.8 superhelical turn
Chromatosome
166 bp, 2 superhelical turn
DNA
Histone octamer
Histone H1
The 10 nm fiber in partially unwound state can be seen to consist of a string of nucleosomes. Photograph kindly provided by Barbara Hamkalo.
The structure of nucleosome

43. Histones are small, positively charged (basic) proteins
DNA packaged into nucleosome
Six-fold DNA compaction
Five abundant histones are H1 (linker histone, 20 kd), H2A, H2B, H3 and H4 (core histones, kd).
The core histones share a common structural fold, called histone-fold domain
The core histones each have an N-terminal “tail”, the sites of extensive modifications

44. Many DNA sequence-independent contacts (
Many DNA sequence-independent contacts (?) mediate interaction between the core histones and DNA

45. The histone N-terminal tails stabilize DNA wrapping around the octamer
The histone tails emerge from the core of the nucleosome at specific positions, serving as the grooves of a screw to direct the DNA wrapping around the histone core in a left-handed manner.

46. Histone H1 binds to the linker DNA between nucleosome, inducing tighter DNA wrapping around the nucleosome

47. The role of H1
Stabilizes the point at which DNA enters and leaves the nucleosome core.
C- tail of H1: stabilizes the DNA between the nucleosome cores.
23 kDa, located outside of nucleosome core, binds to DNA more loosely
Less conserved in its sequence

48. The interaction of DNA with the histone octamer is dynamic
There are factors acting on the nucleosome to increase or decrease the dynamic nature
The dynamic nature of DNA-binding to the histone core is important for access of DNA by other proteins essential genome expression etc.

49. Histone variants and modification
The major mechanisms for the condensing and decondensing of chromatin operate directly through the histone proteins which carry out the packaging.
Short-term changes in chromosome packing modulated by chemical modification of histone proteins
Actively transcribed chromatin: via acetylation of lysine residues in the N-terminal regions of the core histones.
Condensation of chromosomes at mitosis: by the phosphorylation of histone H1.
Longer term differences in chromatin condensation: associated with changes due to stages in development and different tissue types.
Utilization of alternative histone variants, H5 replacing H1 in some very inactive chromatin.

50. Modification of the histone N-terminal tails alters the function of chromatin

51. Interphase chromosomes: chromatin
Heterochromatin
Highly condensed
Transcriptionally inactive
Can be the repeated satellite DNA close to the centromeres, and sometimes a whole chromosome (e.g. one X chromosome in mammals)
Euchromatin: chromatin other than heterochromatin.
More diffused and not visible
The region where transcription takes place
Not homogenous, only a portion (~10%) euchromatin is transcriptionally active where the 30nm fiber has been dissociated to “beads on a string” structure and parts of these regions may be depleted of nucleosome.
DNase I hypersensitivity

52. Euchromatin CpG methylation : CpG island
Methylation of C-5 in the cytosine base of 5’-CG-3’
Occurs in mammalian cells
Signaling the appropriate level of chromosomal packing at the sites of expressed genes
CpG methylation is associated with transcriptionally inactive regions of chromatin
Islands of unmethylated CpG are coincident with regions of DNase I hypersensitivity
“Islands”: surround the promoters of housekeeping genes.
Responsible for epigenetic and may also to RNA silencing

53. Euchromatin
DNase I hypersensitivity

54. Brief summary
Prokaryotic chromosome: closed-circular DNA, domains/loops, negatively supercoiled, HU & H-NS
Eukaryotic chromatin: Histones (octamer: H2A, H2B, H3, H4)+146bp DNA > Nucleosomes + H1 > chromatosome + Linker DNA > beads on string > 30nm fiber > fiber loop + nuclear matrix > highly ordered chromatin > > > chromosome
Eukaryotic chromosome structure: centromere, kinetochore, telomere, hetero- or euchromatin, CpG island and methylation
Genome complexity: noncoding DNA, unique sequence, repetitive DNA, satellite DNA