1. ©2000 Timothy G. Standish Ecclesiastes 3:1, 17 1To every thing there is a season, and a time to every purpose under the heaven: 17I said in mine heart, God shall judge the righteous and the wicked: for there is a time there for every purpose and for every work.

2. ©2000 Timothy G. Standish Controlling Gene Expression: Bacteria Timothy G. Standish, Ph. D.

3. ©2000 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some genes are needed for the function of all cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insulin gene. Neurons, in comparison, don’t express insulin.

4. ©2000 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together

5. ©2000 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose E. coli is unlikely to encounter lactose, so it would be wasteful to produce the proteins needed to metabolize it unless necessary Metabolizing lactose for energy only makes sense when two criteria are met: –Other more readily metabolized sugar (glucose) is unavailable –Lactose is available

6. ©2000 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes: 1 LacZ -  -galactosidase - Enzyme that hydrolyzes the bond between galactose and glucose 2 LacY - Codes for a permease that lets lactose across the cell membrane 3 LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain 4 Repressor - A protein that works with the control region to control expression of the operon

7. ©2000 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: 1 Promoter –Promoters are specific DNA sequences to which RNA Polymerase binds so that transcription can occur –The lac operon promoter also has a binding site for a protein called Catabolite Activator Protein (CAP) 2 Operator –The binding site of the repressor protein –The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

8. ©2000 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose RepressorPromoter LacYLacALacZ Operator CAP Binding RNA Pol. Repressor mRNA Hey man, I’m constitutive Come on, let me through No way Jose! CAP

9. ©2000 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP Lac Repressor X RNA Pol. RNA Pol. Great, I can transcribe! Some transcription occurs, but at a slow rate This lactose has bent me out of shape

10. ©2000 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose RepressorPromoter LacYLacALacZ Operator CAP Binding Repressor mRNA Hey man, I’m constitutive CAP cAMP Lac Repressor X This lactose has bent me out of shape CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. RNA Pol. Yipee…!

11. ©2000 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present RepressorPromoter LacYLacALacZ Operator CAP Binding CAP cAMP CAP cAMP CAP cAMP Bind to me Polymerase RNA Pol. Repressor mRNA Hey man, I’m constitutive Repressor STOP Right there Polymerase Alright, I’m off to the races... Come on, let me through!

12. ©2000 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Trp operon genes encode enzymes involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: –Using a repressor that works in exactly the opposite way from the lac operon repressor –Using a special attenuator sequence

13. ©2000 Timothy G. Standish The Tryptophan Biochemical Pathway O - OOC OH HN H H -2 O 3 P OH H H CH 2 O 5-Phosphoribosyl-  -Pyrophosphate PP i N-(5’- Phosphoribosyl) -anthranilate COO - H CH 2 C HO H O Chorismate - OOC OH -2 O 3 POCH 2 NHNH CHCH CC H OH C H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate NHNH - OOCCH 2 NH 3+ C H Tryptophan H2OH2O Serine Anthranilate COO - NH 2 Glutamate + Pyruvate Glutamine CO 2 +H 2 O -2 O 3 POCH 2 CHCH CC H OH C H NHNH Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate NHNH Indole Anthranilate synthetase (trpE and D) Anthranilate synthetase N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase Tryptophan synthetase

14. ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Present STOP Right there Polymerase Trp Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. RNA Pol. Foiled Again! Repressor mRNA Hey man, I’m constitutive

15. ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Repressor Promo. trpDtrpBLead. Operator trpAtrpCtrpEAten. Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

16. ©2000 Timothy G. StandishAttenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

17. ©2000 Timothy G. Standish 3’ 5’ 3’ Transcription And Translation In Prokaryotes Ribosome 5’ mRNA RNA Pol.

18. ©2000 Timothy G. Standish Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU- UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA- AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGA GCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA- AAA-CCG trpE... Terminator The Trp Leader and Attenuator 4 12 3

19. ©2000 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 4 1 2 3 Terminator hairpin 4 12 3

20. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Starved For Tryptophan 4 1 2 3 RNA Pol. Ribosome Leader peptide Ribosome stalls over sequence 1 and sequence 2 binds to sequence 3 preventing formation of the 3, 4 hairpin Help, I need Tryptophan

21. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present 4 12 3 RNA Pol. Ribosome Leader peptide is released Ribosome passes over sequence 1 and onto sequence 2 allowing sequence 3 to form the 3, 4 hairpin

22. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present RNA Pol. Ribosome The 3, 4 hairpin destabilizes the elongation complex 4 12 3

23. ©2000 Timothy G. Standish 3’ 5’ 3’ The Attenuator When Tryptophan Is Present Ribosome RNA Pol. RNA polymerase falls off ending transcription 4 12 3

24. ©2000 Timothy G. Standish