1. GenomesGenomes Chapter 21

2. Genomes Sequencing of DNA Human Genome Project 1990-2003 6 countries 20 research centers

3. Genome J. Craig Venter in 1992 Whole-genome shotgun approach Sequences random DNA fragments directly

4. Fig. 21-3-3 Cut the DNA into overlapping fragments short enough for sequencing 1 2 3 4 Clone the fragments in plasmid or phage vectors. Sequence each fragment. Order the sequences into one overall sequence with computer software.

5. Genomes Complete genome sequences Human, chimpanzee, E. coli, brewer ’ s yeast Nematode, fruit fly, house mouse,

6. Genomes Genomics: Study of whole sets of genes & their interactions Bioinformatics: Application of computers Storage & Analysis of biological data

7. Genomes Metagenomics DNA Entire groups of species Environmental sample Sequenced Human “microbiome”

8. Figure 21.1

9. Genomes Comparison Evolutionary history of genes Taxonomic groups

10. Genome Phenotype to genotype Red eye fruit flies (w+w or w+w+) Computer analysis of genome Identifies sequences likely to encode proteins Genotype to phenotype

11. Genomes

12. Genome NCBI Genbank BLAST Compare DNA Sequences Compare predicted protein sequences Domains (known aa sequences)

13. Fig. 21-4

14. tatggagaga ataaaagaac tgagagatct aatgtcgcag tcccgcactc gcgagatact 61 cactaagacc actgtggacc atatggccat aatcaaaaag tacacatcag gaaggcaaga 121 gaagaacccc gcactcagaa tgaagtggat gatggcaatg agatacccaa ttacagcaga 181 caagagaata atggacatga ttccagagag gaatgaacaa gggcaaaccc tctggagcaa 241 aacaaacgat gctggatcag accgagtgat ggtatcacct ctggccgtaa catggtggaa 301 taggaatggc ccaacaacaa gtacagttca ttaccctaag gtatataaaa cttatttcga 361 aaaggtcgaa aggttgaaat atggtacctt cggccctgtc cacttcagaa atcaagttaa 421 aataaggagg agagttgata caaaccctgg ccatgcagat ctcagtgcca aggaggcaca 481 ggatgtgatt atggaagttg ttttcccaaa tgaagtgggg gcaagaatac tgacatcaga 541 gtcacagctg gcaataacaa aagagaagaa agaagagctc caggattgta aaattgctcc 601 cttgatggtg gcgtacatgc tagaaagaga attggtccgt aaaacaaggt ttctcccagt 661 agccggcgga acaggcagtg tttatattga agtgttgcac ttaacccaag ggacgtgctg 721 ggagcagatg tacactccag gaggagaagt gagaaatgat gatgttgacc aaagtttgat 781 tatcgctgct agaaacatag taagaagagc agcagtgtca gcagacccat tagcatctct 841 cttggaaatg tgccacagca cacagattgg aggagtaagg atggtggaca tccttagaca 901 gaatccaact gaggaacaag ccgtagacat atgcaaggca gcaatagggt tgaggattag 961 ctcatctttc agttttggtg ggttcacttt caaaaggaca agcggatcat cagtcaagaa

15. Genome Proteomics: Systematic study of all proteins encoded by a genome Proteins carry out most of the cell ’ s activities

16. Application Finding DNA sequence of organisms Predict structure & function of new proteins & RNA sequences Families of related proteins Phylogenic trees evolutionary relationships

17. Application The Cancer Genome Atlas project Monitors 2,000 genes in cancer cells for changes Mutations & rearrangements Lung, ovarian and glioblastoma Compare to normal cells

18. Application DNA sequencing Highlight diseases Specialize tx

19. Genome size Bacteria range from 1 to 6 million base pairs (Mb) Eukaryotes usually larger Humans have 3,200 Mb

20. Table 21-1

21. Fig. 21-UN1 Bacteria Archaea Genome size Number of genes Gene density Most are 1–6 Mb 1,500–7,500 Higher than in eukaryotes Introns None in protein-coding genes Other noncoding DNA Very little Present in some genes Can be large amounts; generally more repetitive noncoding DNA in multicellular eukaryotes Unicellular eukaryotes: present, but prevalent only in some species Multicellular eukaryotes: present in most genes Lower than in prokaryotes (Within eukaryotes, lower density is correlated with larger genomes.) 5,000–40,000 Most are 10–4,000 Mb, but a few are much larger Eukarya

22. Genome Gene density: Number of genes in a given length of DNA Humans & other mammals-lowest Multicellular eukaryotes have many introns “ Junk DNA ”

23. Genome Genomes of humans, rats, & mice 500 noncoding regions-are the same 98.5% of the genome does not code for proteins, rRNAs, or tRNAs 24% regulatory sequences & introns

24. Fig. 21-7 Exons (regions of genes coding for protein or giving rise to rRNA or tRNA) (1.5%) Repetitive DNA that includes transposable elements and related sequences (44%) Introns and regulatory sequences (24%) Unique noncoding DNA (15%) Repetitive DNA unrelated to transposable elements (15%) L1 sequences (17%) Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%)

25. Genome Pseudogene: Former genes, mutated Repetitive genes: Sequences in multiple copies

26. Genome Transposable elements: DNA that move from one site to another Prokaryotes & eukaryotes Barbara McClintock

27. Fig. 21-8

28. Genome Eukaryotic transposable elements 1. Transposons: Move within a genome DNA intermediate 2. Retrotransposons: Move - RNA intermediate

29. Fig. 21-9a Transposon New copy of transposon DNA of genome Transposon is copied Insertion Mobile transposon (a) Transposon movement (“copy-and-paste” mechanism)

30. Fig. 21-9b Retrotransposon New copy of retrotransposon Reverse transcriptase Insertion RNA (b) Retrotransposon movement

31. Genome Alu elements 10% of genome Transposable elements 300 nucleotides Do not code for protein Code for RNA

32. Genome Line-1 or L1 17% genome Retrotransposons 6500 nucleotides Low transposition Regulate gene expression Developing neurons

33. Genome Repetitive DNA not transposons 15% 1. Long sequences of DNA 2. Simple sequence DNA Many copies of repeated short sequences GTTACGTTACGTTACGTTACGTTAC

34. Genome Short tandem repeat (STR) Repeating units of 2 to 5 nucleotides Vary among individuals Centromeres Telomeres

35. Genome Multigene families: Collections of identical or very similar genes on a haploid set of chromosomes Example: Code for rRNA products Single transcript makes all rRNA molecules Transcript sequence repeated many times

36. Fig. 21-10a (a) Part of the ribosomal RNA gene family 18S 28S 18S5.8S rRNA DNA RNA transcripts Nontranscribed spacer Transcription unit

37. Genome Nonidentical genes Hemoglobin Chromosome 16- α g lobulin Chromosome 11-ß globulin Code separately Animal development

38. Fig. 21-10b (b) The human  -globin and  -globin gene families Heme Hemoglobin  -Globin  -Globin  -Globin gene family  -Globin gene family Chromosome 16 Chromosome 11 22 11   22 11   GG AA    Embryo Fetus and adult Adult

39. Evolution Human & chimpanzee genomes differ by 1.2% More Alu elements in humans Several genes are evolving faster in humans Genes involved in defense against malaria and tuberculosis Gene that regulations brain size Genes that code for transcription factors

40. Fig. 21-15 Most recent common ancestor of all living things Billions of years ago 4 3 21 0 Bacteria Eukarya Archaea Chimpanzee Human Mouse 0102030 40 50 60 70 Millions of years ago

41. Evolution FOXP2 gene Vocalization Mutation causes speech impairment 2 aa difference chimps and humans

42. Evolution Humans 23 pairs of chromosomes Chimpanzees 24 pairs Humans & chimpanzees diverged from a common ancestor 2 ancestral chromosomes fused in humans Duplications & inversions result from mistakes during meiotic recombination

43. Figure 21.11 Telomere sequences Centromere sequences Telomere-like sequences Centromere-like sequences Human chromosome Chimpanzee chromosomes 12 13 2

44. Figure 21.12 Human chromosomeMouse chromosomes 16 78 17

45. Figure 21.14 Ancestral globin gene α2α2 α1α1 ζ ζζ ββ αα 2 αα 1 yθyθ  βGG AA β β β ζ α α α Duplication of ancestral gene Mutation in both copies Transposition to different chromosomes Further duplications and mutations Evolutionary time α-Globin gene family on chromosome 16 β-Globin gene family on chromosome 11 

46. Figure 21.16 EGF F FFF F K KK Epidermal growth factor gene with multiple EGF exons Fibronectin gene with multiple “finger” exons Plasminogen gene with a “kringle” exon Portions of ancestral genesTPA gene as it exists today Exon shuffling Exon duplication Exon shuffling

47. Evolution Evo-devo Evolutionary developmental biology Developmental processes in multicellular organisms Genomic information shows minor differences in gene sequence or regulation Results in major differences in form

48. Evolution Homeotic genes Body segments (fruit fly) 180-nucleotide sequence Homeobox Related homeobox sequences have been found in regulatory genes of yeasts, plants, and even eukaryotes

49. Fig. 21-17 Adult fruit fly Fruit fly embryo (10 hours) Fly chromosome Mouse chromosomes Mouse embryo (12 days) Adult mouse