1. pGLO lab

2. The importance of DNA

3. The DNA double helix is the code of life DNA is the code to make proteins The blueprint for all structures in your body which are made of protein DNA is comprised of nucleotides

4. Nulceotides are the monomers of nucleic acid polymers Consist of a sugar, a phosphate, and a nitrogen-containing base Sugar can be deoxygenated Bases contain the genetic information

5. There are 4 kinds of DNA bases

6. Adenine always matches with Thymine, Cytosine always matches with Guanine- Hydrogen bonds hold bases together

7. Living things are extremely complex Cellular machinery is sophisticated and required for life Cellular machinery is made largely of proteins Blueprints for all cellular machinery are contained in genes Genes are inherited from parents Humans have ~30,000 genes

8. Proteins give living things the variety of their structures

9. Protein variety is generated by 1 o structure- the sequence of amino acids which make the protein

10. Figure 2.12 Amino Acids Proteins consist of subunits called amino acids

11. How DNA works Replication Transcription Translation

12. The sequence of DNA bases is the code for the primary structure of proteins

13. All cells require a copy of the genome Genome- all the genes of the cell Human genome is made of DNA DNA is similar in all cells Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein) DNA replication copies all cellular DNA

14. Replication of DNA Figure 21.2

15. The DNA code

16. Computers use binary digital code 01100001 = A 01100010 =B 01000011 =c 00100111 = apostrophe Etc. http://www.geek- notes.com/tools/17/tex t-to-binary-translator/ 01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

17. How does the DNA code work? atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaa gttcgtatggaaggttccgttaacggtcacgagttcgaaatcga aggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgct aaactgaaagttaccaaaggtggtccgctgccgttcgcttggga catcctgtccccgcagttccagtacggttccaaagcttacgttaa acacccggctgacatcccggactacctgaaactgtccttcccgg aaggtttcaaatgggaacgtgttatgaacttcgaagacggtggt gttgttaccgttacccaggactcctccctgcaagacggtgagttc =GFP

18. The DNA code is (nearly) universal It uses groups of 3 bases (codon) 3 bases = 1 codon = 1 amino acid

19. The Central Dogma of Molecular Biology DNA  RNA  Protein DNA  RNA : Transcription RNA  Protein: Translation

20. DNA  RNA  Protein  Trait

21. The Universality of the DNA code makes this possible Firefly gene (Luciferase) in a tobacco plant

22. tRNA’s carry an amino acid at one end, and have an anticodon at the other Figure 21.6 Amino acid (phenylalanine) mRNA Anticodon Amino acid attachment site: Binds to a specific amino acid. Anticodon: Binds to codon on mRNA, following complementary base-pairing rules.

23. The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence

24. In this way, the proteins in nature are virtually limitless

25. Proteins are incredibly diverse at the molecular level Insulin ATP synthase Rubisco Nitrogenase Fibrin A few examples Protein function depends greatly on shape

26. Because the DNA code is universal, genes can be moved from one living thing to another Figure 21.14 (1 of 2) Step 1: Isolate DNA from two sources. Step 2: Cut both DNAs with the same restriction enzyme. Step 3: When mixed, the DNAs recombine by base pairing. Bacterium Plasmid Cell with gene of interest Source (donor) DNA Fragments of source DNA

27. When one DNA molecule is copied to make two DNA molecules, the new DNA contains 1. A) 25% of the parent DNA. 2.B) 50% of the parent DNA. 3.C) 75% of the parent DNA. 4.D) 100% of the parent DNA. 5.E) none of the parent DNA.

28. DNA in action HIV and AIDS Genetic engineering pGLO

29. Genetic Engineering allows DNA to be moved from one organism to another Figure 21.14

30. Green Fluorescent Protein discovered in 1960s by Dr. Frank Johnson and colleagues closely related to jellyfish aequorin absorption max = 470nm emission max = 508nm 238 amino acids, 27kDa “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore amino acid substitutions result in several variants, including YFP, BFP, and CFP 40 Å 30 Å

31. The pGLO plasmid has genes which can be turned on and off ori- origin of replication GFP- green fluorescent protein bla- Beta-lactamase araC- Arabinose What are all the other marks? Why are they there?

32. 2008 Nobel Prize- GFP GFP mice

33. Gene Regulation RNA Polymerase araC ara GFP Operon GFP Gene araC GFP Gene araC GFP Gene Effector (Arabinose) BAD araC BAD RNA Polymerase Effector (Arabinose) araC BAD ara Operon On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP What will happen on the Ara (+) plates? What will happen on the Ara (-) plates ?

34. 9/8/201534 Grow? Glow? Follow protocol On which plates will colonies grow? Which colonies will glow?