3. DNA DNA. DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell.

4. DNA stands for deoxyribose nucleic acid This chemical substance is present in the nucleus of all cells in all living organisms. DNA controls all the chemical changes which take place in cells. The kind of cell which is formed, (muscle, blood, nerve etc) is controlled by DNA. The kind of organism which is produced (buttercup, giraffe, herring, human etc) is controlled by DNA

5. Composition of DNA

6. DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides. Each nucleotide is made up of a sugar called deoxyribose a phosphate group -PO4 and a nitrogen base.

7. Components and structure of DNA A very long molecule. 4 nitrogenous bases:

8. The most common organic bases are Adenine(A) Thymine(T) Cytosine(C) Guanine (G)

9. Chargaff’s rules The relative amounts of adenine and thymine are the same in DNA The relative amounts of cytosine and guanine are the same. Named after Erwin Chargaff

10. 9 Discovery of DNA Structure Erwin Chargaff showed the amounts of the four bases on DNA ( A,T,C,G) In a body or somatic cell: A = 30.3% T = 30.3% G = 19.5% C = 19.9%

11. The bases always pair up in the same way Adenine forms a bond with Thymine and Cytosine bonds with Guanine AdenineThymine Cytosine Guanine

12. PO 4 thymine PO 4 adenine cytosine PO 4 guanine

13. Two Kinds of Bases in DNA Pyrimidines aresingle Pyrimidines aresingle ring bases. Purines are double Purines are double C ring bases. ring bases. C C C C N N N N N C

14. Thymine and Cytosine are pyrimidines Thymine and cytosine each have one ring of carbon and nitrogen atoms. Thymine and cytosine each have one ring of carbon and nitrogen atoms. C C C C N N O N cytosine C C C C N N O O thymine C

15. Adenine and Guanine are purines Adenine and guanine each have two rings of carbon and nitrogen atoms. Adenine and guanine each have two rings of carbon and nitrogen atoms. C C C C N N N Adenine N N C C C C C N N O N Guanine N N C

16. The deoxyribose, the phosphateand one of the bases adenine deoxyribose PO 4 Combine to form a nucleotide

17. PO 4 sugar-phosphate backbone + bases Joined nucleotides A molecule of DNA is formed by millions of nucleotides joined together in a long chain. In fact, the DNA usually consists of a double strand of nucleotides. The sugar-phosphate chains are on the outside and the strands are held together by chemical bonds between the bases.

18. Rosalind Franklin Used X-Ray diffraction to get information about the structure of DNA:

19. Structure of DNA Discovered in 1953 by two scientists: James Watson (USA) Francis Crick (GB) Known as the double-helix model.

20. sugar-phosphate chain bases THE DOUBLE HELIX

21. PO 4 2-stranded DNA

22. The double-helix A twisted ladder with two long chains of alternating phosphates and sugars. The nitrogenous bases act as the “rungs” joining the two strands connected by H bonds.

23. How long is the DNA molecule?

24. Chromosomes & DNA replication The nucleus of one human cell contains approximately 1 meter of DNA. Histones = DNA tightly wrapped around a protein Nucleosome:

26. DNA replication Must occur before a cell divides. Each new cell needs a copy of the information in order to grow.

27. Before a cell divides, the DNA strands unwind and separate. Each strand makes a new partner by adding the appropriate nucleotides. The result is that there are now two double-stranded DNA molecules in the nucleus. So that when the cell divides, each nucleus contains identical DNA. This process is called replication.

28. PO 4 The strands separate

29. PO 4 Each strand builds up its partner by adding the appropriate nucleotides

30. TRANSCRIPTION DNA is copied into mRNA with the aid of RNA polymerase. Copies genetic code of DNA by matching bases. Occurs in the nucleus. DNA changing to mRNA

31. RNA Very similar to DNA. Exceptions: 1. Uracil replaces thymine 2. Single-stranded 3. Ribose is the 5-carbon sugar

32. tRNA (transfer) approx. 80 nucleotides in length. Cross-like shape At one end an amino acid is attached At the other end there is an anticodon Acts like a truck

33. Polypeptide assembly Translation = reading or “translating” the RNA code to form a chain of amino acids. Known as protein synthesis Occurs in the cytoplasm. tRNA mRNA Amino acid

34. 3 Types of RNA Types of RNAWhere are they producedFunctionStructure mRNAnucleusCarries the information in codons that determine the order of amino acids tRNAOther genes in the nuclear DNA code for tRNA molecules. Carries the anticodon and picks up the amino acid to bring to the rRNA rRNAOther genes in the nucleus produces the rRNA.rRNA molecules combine with protein to form the ribosomes, which serve as the base for interactions between mRNA codons and tRNA anticodons in translation in the cytoplasm

35. The sequence of bases in DNA forms the Genetic Code A group of three bases (a triplet) controls the production of a particular amino acid in the cytoplasm of the cell The different amino acids and the order in which they are joined up determines the sort of protein being produced

36. Codons A three letter “word” that specifies an amino acid.

37. Ser-Cyst-Val-Gly-Ser-Cyst Ala Val Val-Cyst-Ser-Ala-Ser-Cyst-Gly Val- Cyst-Ala-Ala-Ser-Gly This is a small, imaginary protein molecule showing how a sequence of 5 different amino acids could determine the shape and identity of the molecule. Each amino acid ( Serine, Cysteine, Valine, Glycine and Alanine) is coded for by a particular triplet of bases.

38. For example Cytosine Adenine Codes for Valine Cytosine (C) Guanine (G) Adenine (A) Codes for Alanine Thymine

39. This is known as the triplet code Each triplet codes for a specific amino acid CGA - CAA - CCA - CCA - GCT - GGG - GAG - CCA - AlaValGly ArgProLeuGly AlaValGly ArgProLeuGly The amino acids are joined together in the correct sequence to make part of a protein

40. The proteins build the cell structures. They also make enzymes. The DNA controls which enzymes are made and the enzymes determine what reactions take place. The structures and reactions in the cell determine what sort of a cell it is and what its function is. So DNA exerts its control through the enzymes.

41. A sequence of triplets in the DNA molecule may code for a complete protein Such a sequence forms a gene There may be a thousand or more bases in one gene.

42. Reading the genetic code The genetic code is responsible for building all the proteins in the body using 20 different amino acids. How many 3 letter words can you make from the letters A,T,G and C? Answer: 64

43. Question 1 Which of the following are components of nucleotides? (a) deoxyribose (b) amino acids (c) phosphate (d) enzymes (e) organic bases

44. Question 2 Which of the following represent a correct pairing of bases? (a) adenine with thymine (b) adenine with guanine (c) thymine with adenine (d) guanine with cytosine (e) thymine with thymine

45. Question 3 DNA molecules are formed from (a) organic bases (b) amino acids (c) deoxyribose (d) nucleotides

46. Question 4 Which of the following are organic bases? (a) Valine (b) Guanine (c) Thymine (d) Serine

47. Question 5 Replication of DNA occurs (a) During cell division (b) before cell division (c) at any time

48. Question 6 A nucleotide triplet codes for (a) a protein (b) an amino acid (c) an enzyme (d) an organic base

49. Question 7 Transcribe this DNA sequence into RNA, then translate the RNA into an amino acid chain using the genetic code circle on the next slide. TAGCCGACAGGCCTCTTTACT An example of a DNA sequence might be CCC TGT GGA GCC ACA CCC TAG translate into mRNA GGG ACA CCU CGG UGU GGG AUC You can decode triplet by triplet. Start from the inside of the wheel: find the first letter of your codon in the centre of the wheel and work outwards, through the second ring (with the next letter) and so on, to find the corresponding amino acid. This would make the amino acid chain: P - C - G - A - T - STOP Proline-Cysteine-Glycine-Alanine-Threonine-STOP

50. Genetic code:

51. Answers 1. A,C,E 2. A,C,D 3. D 4. B,C 5. B 6. B 7. AUC, GGC, UGU, CCG, GAG, AAA,UGA MET, GLY, CYS, PRO, GLU, LYS, STOP