1. DNA Study Guide  35 multiple choice  1 DNA problem (replication, transcription, & translation)

2. Experiments leading to the structure of DNA… a) What happened when Griffith mixed heat-killed, disease causing bacteria with live harmless bacteria? The mice died b) What did Avery’s experiments prove about the transformation factor? It was DNA

3. Experiments leading to the structure of DNA… c) State Chargaff’s Rule A pairs with T C pairs with G d) What did Wilkins and Franklin learn with their x-ray diffraction photographs? DNA molecule is arranged as a tightly coiled double helix

4. Experiments leading to the structure of DNA… e) Which scientist (s) are given credit for determining the structure of DNA? - Francis Crick and James Watson e) What is so important about DNA?  It stores and transmits our genetic information!

5. Nucleotide unique to DNA Thymine!! Bases in DNA:  A (adenine)  T (thymine)  C (cytosine)  G (guanine) DEOXYRIBOSE THYMINE

6. Nucleotide unique to RNA Uracil!! Bases in RNA:  A (adenine)  U (uracil)  C (cytosine)  G (guanine) RIBOSE URACIL

7. Nucleotides – building blocks of DNA & RNA 1. What is different about these nucleotides?  The nitrogen base  DNA – thymine  RNA - uracil  Sugar  DNA – deoxyribose  RNA - ribose 2. What is the same about them?  Both have a phosphate group  Both have the bases A, C, G

8. 3. What instructions do your genes carry?  Instructions for making a protein 4. What are purines and pyrimidines?  Nitrogen bases found in DNA & RNA nucleotides 5. What is true about the percentage of purines and pyrimidines in a DNA molecule?  They are equal 6. In RNA, what base does adenine pair with?  URACIL

9. DNA Replication 7. What is the purpose of DNA replication? Copy DNA (for cell division later) 8. What is the complementary DNA strand? A T T C G C A T G G T A A G C G T A C C 9. Describe the strands of the new DNA molecule. Each with 1 new strand that is complementary to the original strand.

10. DNA Replication 10. Name the enzyme responsible for adding nucleotides to the growing DNA chain. DNA Polymerase

11. Name that Process… 11. Process that makes RNA molecules: Transcription 12. Cell uses information from mRNA to produce proteins: Translation

12. Protein Synthesis 13. Types of RNA needed for protein synthesis… mRNA tRNA rRNA

13. Protein Synthesis 15. Which type of RNA forms ribosomes?  rRNA 16. Where does mRNA go once it is made? (hint: organelle responsible for making proteins)  ribosome 17. During translation, how does your body determine the type of amino acid to add to the polypeptide chain?  Codon on the mRNA & the complementary anticodon on the tRNA where the amino acid is attached

14. Protein Synthesis 18. How does tRNA act as an “interpreter” during protein synthesis?  It brings an amino acid to its correct codon 19. What is the name for a nucleotide triplet in mRNA, which identifies a specific amino acid?  CODON 20. How many codons are needed to specify 3 amino acids?  THREE

15. Protein Synthesis 21. Why is it possible for an amino acid to be specified by more than one kind of codon?  There are 64 codons that code for amino acids and only 20 amino acids 22. During translation, what happens when a tRNA anticodon binds to a mRNA codon?  The amino acid detaches from the tRNA and attaches to the end of a growing protein chain

16. Mutation open-ended: What’s a mutation – What are the 3 types – Which type is the most disastrous? Can mutations be passed on? Identify a common mutagen.

17. DNA: CCATTGAGATCAATTGCGGTAT DNA:

18. DNA:TACAGATTCCAAGGGCTCTCTGATT mRNA: tRNA: AA: