1. The human genome of is found where in the human body?
Nucleus
Ribosome
Smooth ER
Cell membrane

2. The cellular structure where proteins are made is called the
Nucleus
Smooth ER
Ribosome
Cell membrane

3. DNA and Biotechnology

4. Announcements Ch 21- today Ch 21, 17- Wednesday
Bone & muscle labs- Due Wednesday
Ch 21, 17 online quizzes- Due Friday
Quiz 10- Friday (chs 21, 17)
Lab today- pGLO (DNA transformation)

5. Lecture Outline DNA- Structure, function, and importance How DNA works
The central dogma
Transcription and Translation
The DNA code
DNA replication

6. The importance of DNA

7. The DNA double helix is the code of life
The blueprint for all structures in your body which are made of protein
DNA is comprised of nucleotides

8. Nulceotides are the monomers of nucleic acid polymers
Consist of a sugar, a phosphate, and a nitrogen-containing base
Sugar can be deoxygenated
Bases contain the genetic information

9. There are 4 kinds of DNA bases

10. Adenine always matches with Thymine, Cytosine always matches with Guanine- Hydrogen bonds hold bases together

11. Living things are extremely complex
Cellular machinery is sophisticated and required for life
Cellular machinery is made largely of proteins
Blueprints for all cellular machinery are contained in genes
Genes are inherited from parents
Humans have ~30,000 genes

12. Proteins give living things the variety of their structures

13. Protein variety is generated by 1o structure- the sequence of amino acids which make the protein

14. Amino Acids Proteins consist of subunits called amino acids
Figure 2.12

15. How DNA works
Replication
Transcription
Translation

16. The sequence of DNA bases is the code for the primary structure of proteins

17. All cells require a copy of the genome
Genome- all the genes of the cell
Human genome is made of DNA
DNA is similar in all cells
Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein)
DNA replication copies all cellular DNA

18. Replication of DNA
Figure 21.2

19. In vivo, enzymes such as DNA polymerase make DNA replication happen

20. The DNA code

21. Computers use binary digital code
= cheeseburger deluxe
= A =B =c
= apostrophe
Etc.

22. How does the DNA code work?
atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

23. The DNA code is (nearly) universal
It uses groups of 3 bases (codon)
3 bases = 1 codon = 1 amino acid

24. And what are these U’s for?

25. RNA is ribonucleic acid
Ribose sugar is not deoxygenated
RNA is single-stranded
RNA has Uracil, not Thymine
There are many kinds: mRNA, rRNA, tRNA, siRNA, etc.

26. RNA can fold back on itself
Single strand offers greater flexibility

27. Kinds of RNA
mRNA
tRNA

28. The Central Dogma of Molecular Biology
DNA RNA Protein
DNARNA : Transcription
RNA Protein: Translation

30. When one DNA molecule is copied to make two DNA molecules, the new DNA contains
 A) 25% of the parent DNA.  
B) 50% of the parent DNA.  
C) 75% of the parent DNA.  
D) 100% of the parent DNA.  
E) none of the parent DNA.

31. DNA RNA Protein Trait

32. The Universality of the DNA code makes this possible
Firefly gene (Luciferase) in a tobacco plant

33. Transcription and Translation

34. Transcription: DNA RNA

35. DNA Codes for RNA, Which Codes for Protein
Figure 21.3

36. DNA information is transcribed into mRNA
Note in DNA: sense strand vs. antisense strand

37. Translation: RNA Protein

38. tRNA’s carry an amino acid at one end, and have an anticodon at the other
attachment site:
Binds to a specific
amino acid.
Amino acid
(phenylalanine)
Anticodon:
Binds to codon on mRNA,
following complementary
base-pairing rules.
Anticodon
mRNA
Figure 21.6

39. The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence

40. tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete

42. A) 2 amino acids. B) 3 amino acids. C) 5 amino acids.
We would expect that a 15-nucleotide mRNA sequence will direct the production of a polypeptide that consists of
A) 2 amino acids.  
B) 3 amino acids.  
C) 5 amino acids.  
D) 7 amino acids.  
E) 15 amino acids.  

43. Viruses exploit the universality of the DNA code to take control of cells
Basic life cycle of Viruses
Viruses are obligate intracellular parasites
They inject their genetic material into their host
Host machinery is commandeered to mass-produce virus
Viruses burst host cell to infect other cells

44. Virus Structure Many viruses contain only:
Protein capsid
Genome (DNA or RNA)
Some viruses have a phosopholipid bilayer envelope

45. Bacteria are infected by viruses, too
Bacteriophages attacking bacterial cell
The lytic bacterial life cycle

46. Bacteriophages Infect bacteria
Cause formation of plaques on a lawn of agar in bacteria

47. Bacteria use restriction enzymes to defend against viral DNA

48. Restriction enzymes cut very specific sequences of DNA
Hundreds of different restriction enzymes have been found
Named after bacteria in which they are found

49. Viruses such as T4 fight back with DNA ligase
Ligase glues DNA back together
Viral countermeasures against bacterial cell defenses

50. Scientists commandeer these enzymes to perform DNA manipulations
Ligase and restriction enzymes allow any sequence of DNA to be cut and pasted at will
Plasmids, small loops of bacterial DNA, can be modified with any DNA
Because the genetic code is universal, DNA will be read in the same way

51. Plasmid DNA manipula-tion is at the heart of biotech-nology
Bacterium
Cell containing gene
of interest
Gene inserted into
plasmid
Bacterial
chromosome
Plasmid
Gene of
interest
Recombinant
DNA (plasmid)
DNA of
chromosome
Plasmid put into
bacterial cell
Recombinant
bacterium
Host cell grown in culture
to form a clone of cells
containing the “cloned”
gene of interest
Gene of
interest
Protein expressed
by gene of interest
Copies of gene
Protein harvested
Basic research and
various applications
Basic
research
on gene
Basic
research
on protein
Gene for pest
resistance inserted
into plants
Gene used to alter
bacteria for cleaning
up toxic waste
Protein dissolves
blood clots in heart
attack therapy
Human growth hor-
mone treats stunted
growth

52. The pGLO plasmid has ori- origin of replication
1. GFP- green fluorescent protein
2. bla- beta-lactamase (confers ampicillin resistance)
3. araC- Arabinose regulator protein (regulates GFP expression)

53. 1. GFP: Green Fluorescent Protein
40 Å
30 Å
discovered in 1960s by Dr. Frank Johnson and colleagues
closely related to jellyfish aequorin
absorption max = 470nm
emission max = 508nm
238 amino acids, 27kDa
“beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore
amino acid substitutions result in several variants, including YFP, BFP, and CFP
Previous Slide: Immunofluorescence
Key Points of Current Slide:
try to know the key points on this slide well so that you’re not reading it to the class.
the absorption maximum is very close to that of the FITC fluorochrome, so in our lab we will be using the FITC filter to excite GFP
CAs: FYI
autofluorescence (when cells naturally fluoresce without the addition of a fluorochrome) occurs in the C. elegans gut; using a normal GFP filter this looks yellow, but under FITC filter looks green.
Next Slide: GFP Fusion and Protein Localization
Transition: GFP applications are slightly different from those of fluorophores that are just attached post-translationally to proteins or antibodies. Instead, the GFP gene is commonly fused to a given gene of interest.

54. 2008 Nobel Prize- GFP
GFP mice

55. Using GFP as a biological tracer
GFP can be fused to cellular proteins
Using GFP as a biological tracer
With permission from Marc Zimmer

56. GFP fusions are useful in Biology and medicine
Nervous system of C. elegans worm illuminated by GFP
GFP fused to Huntingtin protein in monkey to study Huntington’s disease

57. 2. bla: β-lactamase enzyme can destroy penicillin and other β-lactam antibiotics

58. Antibiotic resistance genes are found commonly on plasmids and can be shared between bacteria by conjugation
Genes for making a sex pilus also are often found encoded on plasmids
Bacterial conjugation is sex without reproduction

59. 3. araC: araC regulates pGLO expression through the presence of arabinose
Arabinose is a 5-carbon sugar, different from ribose

60. Gene Regulation

61. Q: What is “regulation”?*
"When I was warning about the danger ahead on Wall Street months ago because of the lack of oversight, Senator McCain was telling the Wall Street Journal -- and I quote -- 'I'm always for less regulation.' " – Sen. Barack Obama
“Senator Obama was silent on the regulation of Fannie Mae and Freddie Mac, and his Democratic allies in Congress opposed every effort to rein them in…last year he said that subprime loans had been, quote, “a good idea.””- Sen. John McCain
* Slide created, September 2008

62. Regulation means control
Prokaryotic cells require efficiency
Eukaryotic cells must differentiate

63. Eukaryotic genes can be turned on and off
Females only use a single X chromosome per cell
Genes from the other chromosome are not used in that cell

64. Random inactivation of one X chromosome creates a tortoiseshell pattern in cat fur

65. Genes are regulated in eukaryotes in more complex ways
Each step in the process of gene expression is a possible point of control
The cell capitalizes on each one

66. The job of master control genes is to turn many genes on or off
The gene eyeless turns on many genes involved in formation of eyes
When eyeless is mutated, eyes do not form

67. Master control genes control formation of entire organs
-Drosophila eyeless gene can be artificially turned on in non-eye cells

68. Prokaryotes must also regulate genes

69. Example: β- Galactosidase can hydrolyze lactose2
galactose
Well, Humans also produce β-galactosidase though the human version of this enzyme is called lactase.
Does anyone know what lactase deficiency is called? [No? ok./You’re right]
Let me tell you how this enzyme works:
β-galactosidase catalyzes the breakdown of a disaccharide, lactose, into two monosaccharides: glucose and galactose.
Glucose is the prime energy source for many organisms. [Any ideas now?]
In lactose intolerance, undigested lactose causes intestinal discomfort.
Transition: We know that both the amount produced and the efficiency of individual β-galactosidase are tightly regulated, which begs the question…
lactose b -
galactosidase
glucose
(aka lactase in humans) 11

70. b - galactosidase β-galactosidase is our enzyme of choice.
This enzymatic protein is a tetramer.
That means that it is comprised of how many identical subunits?
The active sites of this enzyme are located at the junctions of the subunits…here…here…here…and here.
This enzyme is produced by many different organisms and has been very thoroughly studied.
You will be studying its production in a bacteria and its activity using enzyme purified from a mold.
Transition: So what is exactly is beta-galactosidase and what does it do?… 10

71. When lactose is present, transcription is activated

72. In the absence of lactose, the lac operon is repressed by the lac repressor protein

73. araC allows expression of arabinose-digesting genes in the presence of arabinose
4/21/2017

74. In pGLO, arabinose-digesting genes are removed, and araC is fused to GFP
How do you think this fusion was made?
What are the structural sequences? The regulatory sequences?
What happens when we add arabinose sugar to these bacteria?
What do you think is meant by “reporter gene”?

75. On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP
Gene Regulation
RNA Polymerase
araC
ara GFP Operon
GFP Gene
Effector (Arabinose) B A D
araC
RNA Polymerase
Effector (Arabinose)
ara Operon
What will happen on the Ara (+) plates?
What will happen on the Ara (-) plates?

76. Which colonies will glow?
Grow? Glow?
Which colonies will glow?
Follow protocol
On which plates will colonies grow?
Which colonies will glow?
LB/Amp
LB/Amp/Ara LB
4/21/2017 76

77. Plasmids with novel structural and regulatory genes are now easily manipulated by undergraduates
iGEM is an annual undergrad bioengineering contest
Engineering bacteria to smell better

78. A) Transfer RNA B) Messenger RNA C) RNA transcriptase D) Ribosomal RNA
Which strand carries the DNA's instructions for synthesizing a particular protein from the nucleus to the cytoplasm?
A) Transfer RNA
B) Messenger RNA
C) RNA transcriptase
D) Ribosomal RNA

79. Why are the complementary base pairing rules so important when a cell needs to copy its DNA?
A) The cells need both strands to be accurate because each strand codes for one half of the gene.
B) As long as there is one strand, a copy can be made by following the pairing rules.
C) Unless the bases pair up correctly, the DNA strand can break apart.
D) Transcription cannot proceed unless the pairs are in the proper sequence.