1.  2 phases  2 phases : 1.Transcription 2.Translation  DNA  RNA  Protein

2. RNA(ribonucleic acid) DNA (deoxyribonucleic acid)  How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid) ?

3. RNAsugar ribose 1. RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2. RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3. RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

4.  DNA can “unzip” itself and RNA nucleotides match up to the DNA strand  This process is started and controlled by an enzyme called RNA polymerase.  Both DNA & RNA are formed from NUCLEOTIDES and are called NUCLEIC acids.

5. RNADNA  What would be the complementary RNA strand for the following DNA sequence?  DNA 5’-GCGTATG-3’

6.  Three types ofRNA  Three types of RNA : A. messenger RNA (mRNA) B.transfer RNA (tRNA) C. ribosome RNA (rRNA)  Remember: all produced in the nucleus

7.  Carries instructions from DNA to the ribosome.  Tells the ribosome what kind of protein to make

8.  …DNA controlled cell function by serving as a template for PROTEIN structure.  3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID)  AMINO ACIDS are the building blocks of proteins.

9.  The cell uses information from “messenger” RNA to produce proteins

10. methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

11.  Part of the structure of a ribosome  Helps in protein production tRNA A go-getter Gets the right parts to make the right protein according to mRNA instructions

12. amino acid attachment site UAC anticodon methionine amino acid

14. primary structure of a protein  The end products of protein synthesis is a primary structure of a protein. amino acid peptide bonds  A sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

15. 1. Why is transcription necessary? 2. Describe transcription. 3. Why is translation necessary? 4. Describe translation. 5. What are the main differences between DNA and RNA. 6. Using the chart identify the amino acids coded for by these codons: UGGCAGUGC

16. 1. Why is transcription necessary? Transcription makes messenger RNA (MRNA) to carry the code for proteins out of the nucleus to the ribosomes in the cytoplasm. 2. Describe transcription. RNA polymerase binds to DNA, separates the strands, then uses one strand as a template to assemble MRNA. 3. Why is translation necessary? Translation assures that the right amino acids are joined together by peptides to form the correct protein.

17. 4. Describe translation. The cell uses information from MRNA to produce proteins. 5. What are the main differences between DNA and RNA. DNA has deoxyribose, RNA has ribose; DNA has 2 strands, RNA has one strand; DNA has thymine, RNA has uracil. 6. Using the codon chart, identify the amino acids coded for by these codons: UGGCAGUGC tryptophan-glutamine-cysteine