1. Mutations!

2. What is a gene? Discuss, be ready to share.
A sequence of DNA that codes for a specific protein (or proteins) associated with a trait, characteristic, or genetic condition
What do you know about mutations? Discuss, be ready to share.

3. Gene Mutations
Gene mutations: occur in a single gene, usually during mitosis or meiosis
Gene mutations occur if DNA polymerase does its job incorrectly
“Point” gene mutations – occur in one/few bases (3 types)
1) Insertion
Adding a base/bases
2) Deletion
Removing a base/bases
3) Substitution
Swapping out a base/bases
Point mutations can have no effect, can improve the trait, or can have a negative effect on the trait.

4. Example mutation - hemoglobin
What do you know about hemoglobin? Discuss, be ready to share.
Hemoglobin carries oxygen in red blood cells (don’t need to takes notes on this!)
“HBB” gene for hemoglobin on chromosome #11 (out of 23)
HBB – 1600 base pairs, 3 exons
mRNA with introns, promoter, TATA removed: 444 base pairs
Mutant version of HBB can causes red blood cells to clump.
One bad gene = some clumping of red blood cells
2 bad genes = “sickle cell anemia”

5. Typical hemoglobin
Transcribe and translate this portion of the HBB gene:
GACTGAGGACTCCTC
mRNA: CUGACUCCUGAGGAG
Leucine-Threonine-Proline-Glutamic acid-Glutamic acid

6. Deletion and insertion mutations (using hemoglobin as an example)
Transcribe and translate this portion of the mutated HBB gene:
GCTGAGGACTCCTC
mRNA: CACUCCUGAGGAG
Arginine-Leucine-Leucine-Arginine -…and extra bases
Example of a “frameshift” – all codons are “shifted”
Deletion mutations (frameshift):
Usually result in different primary structure  major protein problems
Insertion mutations (frameshift):

7. Substitution mutations (using hemoglobin as an example)
Transcribe and translate this portion of the mutated HBB gene:
GACTGAGGACTTCTC
mRNA: CUGACUCCUGAAGAG
Leucine-Threonine-Proline-Glutamic acid-Glutamic acid
Substitution mutations
Might not have an effect on the protein (don’t matter)
Could be harmful (see next slide)
Could put a stop codon in the wrong place
Could code for an incorrect amino acid with big consequences

8. Substitution mutations - 2 (using hemoglobin as an example)
Transcribe and translate this portion of the mutated HBB gene:
GACTGAGGACACCTC
mRNA: CUGACUCCUGUGGAGAAGUCU
Leucine-Threonine-Proline-Valine-Glutamic acid
This single amino acid change completely changes the protein!

9. Chromosomal mutations (in tonight’s reading)
Mistakes in large portions of an entire chromosome – BIG consequences.
Licorice models returned!