Download presentation
Presentation is loading. Please wait.
Published byBarry O’Brien’ Modified over 9 years ago
1
Longterm Estuary Assessment Group NOAA '07 Eco Impacts of Hypoxia Developing biomarkers of reproductive health in fish and amphibians of the Barataria-Terrebonne Estuary LaFleur, Pitre, Lasseigne, and Nelson nicholls state university LaFleur Lab
2
Graphic from Restore or Retreat: www.restoreorretreat.org The Barataria-Terrebonne Estuary is impaired NOAA '07 Eco Impacts of Hypoxia Having been isolated from freshwater inputs it is lacks flushing, sheet flow, and an ecological flood pulse lack of flow saltwater intrusion land-loss
3
The 46-year mean stage of the Atchafalaya still reflects an ecological flood pulse USACE Butte La Rose Gage 03120 ('59-'04)
4
In the Upper Barataria basin, Hypoxia can occur But it is usually associated with Rainwater events, rather than flood stage from Estay and Fontenot (thesis)
5
one project proposes diverting 300,000 cfs water into the BTE; up to 6 sq mi / year; at a cost of $25 / cubic yard Graphic from Restore or Retreat: www.restoreorretreat.org Our estuary is slated for largescale hydrologic modifications: NOAA '07 Eco Impacts of Hypoxia
6
Pipeline Slurry System A more recently presented scenario would utilize a sediment pipeline slurry system to build land even quicker: up to15 sq mi / year; at a cost of $4 /cubic yard NOAA '07 Eco Impacts of Hypoxia
7
MY OBJECTIVES In preparation for hydrologic changes due to further deterioration or restoration activities in our estuary, my lab has begun a survey to monitor behavioral indicators of reproduction in amphibians of the estuary to monitor anatomical indicators of reproduction in amphibians of the estuary to monitor molecular indicators of reproduction in amphibians of the estuary NOAA '07 Eco Impacts of Hypoxia
8
2 3 Site 1 Choctaw swamp; Site 2 Chacahoula swamp Site 3 Nicholls’ Environmental Ag Facility Site 4 Falgout Canal fw / brackish marsh Site 5 fish only at Isle Dernieres Barrier Islands 5 1 4 NOAA '07 Eco Impacts of Hypoxia
9
Reproductive behavior is being surveyed in three LAMP survey routes: spanning Lafourche and Terrebonne Parishes NOAA '07 Eco Impacts of Hypoxia
10
temp calls In 2007, Spring Peepers reached peak calling in Feb Northern Cricket frogs peaked in Jan, but are still calling
11
Confirmed Hyla avivoca Choctaw Swamp, Lafourche Parish
12
Proposed Expansion of Geographic Range to the BTES, south of the Mississippi River Conant and Collins.1991
13
ovary liver Selected species are collected, dissected, and anatomical indicators are examined NOAA '07 Eco Impacts of Hypoxia
14
SpeciesRepro Behavior PreservedRepro AnatomyMolec. Biomarker Bufo valliceps XXXX Acris gryllus XX Hyla cinerea XX Hyla squirella XX Hyla versicolor/ chrysoscelis XX Hyla avivoca* X X Pseudacris crucifer XX Gastrophryne carolinensis XX Rana catesbeiana XXX Rana grylio X Rana clamitans XXXX Rana utricularia Amphiuma tridactylum Notophthalmus viridescens XXXXXX XXXXXX XXXXXX XXXX Amphibian Survey Matrix
15
Approach to designing biomarkers for estrogen-induction Injection of estradiol into males Isolation of liver RNA RT-PCR for Vtg, Chg from homogenates using degenerate and heterologous primers NOAA '07 Eco Impacts of Hypoxia
16
vitellogenins and choriogenins of teleost choriogenins and vitellogenins HETEROSYNTHETIC ORIGIN OF TELEOSTEAN EGG PROTEINS follicle cells vitelline envelope precursor to the chorion yolk of oocyte Estrogen induced Liver synthesis micropyle NOAA '07 Eco Impacts of Hypoxia
17
Choriogenin Primers Row 78 TTCAGGTTCCAGAATTCTGAC Row 81 CATTGGTTCATATCGCTGTCT Vitellogenin Primers Row 8 CGATATTGACATGTTTCCAA Row 24 TACCAGCTTGGTTTCTACCT Choriogenin and Vitellogenin primers derived from F. heteroclitus, the mummichog. Row 78 and Row 81 produce a 450 bp product while Row 8 and Row 24 produce a 729 bp product NOAA '07 Eco Impacts of Hypoxia
18
a b c d Choriogenin cDNAs indicating normal female reproductive activity. choriogenin 450 bp F.g. liver F.c. liver G.a. liver A.t. ovary NOAA '07 Eco Impacts of Hypoxia
19
(Estrogen-injected males) a= Fundulus grandis liver, b= Fundulus chrysotus liver, c= Amphiuma tridactylum liver vitellogenin a b c 729 bp NOAA '07 Eco Impacts of Hypoxia
20
(Non-injected males) Three wild-caught males showing the presence of female specific RNA a= Bufo valliceps liver, b= Amphiuma tridactylum liver c= Gambusia affinis a b c vitellogenin 729 bp NOAA '07 Eco Impacts of Hypoxia
21
Through collaborations between the labs of LaFleur, Ferrara and Fontenot we have established overlapping projects of the estuarine fauna, including monitoring of finfish, larval fish, and amphibians. Fish and Amphibians NOAA '07 Eco Impacts of Hypoxia
22
Summary Documented reproductive behavior through calls of 12 local Anuran species. Established herpetology collection. Tracking reproductive seasons by measuring GSI on 4 Anurans, 1 Salamander, 3 fish. Molecular biomarkers were amplified using RT-PCR on 3 anurans, 1 Salamander, 3 fish. Poised to implement reproductive survey to include water quality and expanded sampling regime. Proposed range extension for Hyla avivoca to include wetlands of the BTES. LaFleur Lab
24
Post Katrina Directions Amphibian and Fish reproduction will be utilized as a longterm assessment tool for environmental health of the estuary Nicholls has been awarded a grant for restoration planting by NOAA Nicholls has signed an MOU with NRCS for restoration plant propagation at Nicholls Farm LaFleur, Boopathy, and Zou are committed to longterm monitoring programs that will offer consistency over time NOAA '07 Eco Impacts of Hypoxia
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.